ID: 1083897104

View in Genome Browser
Species Human (GRCh38)
Location 11:65625430-65625452
Sequence AAGCTGCGCTCCTCCAGCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083897104_1083897106 -10 Left 1083897104 11:65625430-65625452 CCTGAGCTGGAGGAGCGCAGCTT 0: 1
1: 0
2: 1
3: 16
4: 141
Right 1083897106 11:65625443-65625465 AGCGCAGCTTGGAGACAGCCCGG 0: 1
1: 0
2: 0
3: 21
4: 234
1083897104_1083897112 15 Left 1083897104 11:65625430-65625452 CCTGAGCTGGAGGAGCGCAGCTT 0: 1
1: 0
2: 1
3: 16
4: 141
Right 1083897112 11:65625468-65625490 CGAGCCCCCGGACCCCTTGCCGG 0: 1
1: 0
2: 0
3: 7
4: 111
1083897104_1083897108 3 Left 1083897104 11:65625430-65625452 CCTGAGCTGGAGGAGCGCAGCTT 0: 1
1: 0
2: 1
3: 16
4: 141
Right 1083897108 11:65625456-65625478 GACAGCCCGGGCCGAGCCCCCGG 0: 1
1: 0
2: 4
3: 27
4: 231
1083897104_1083897107 -9 Left 1083897104 11:65625430-65625452 CCTGAGCTGGAGGAGCGCAGCTT 0: 1
1: 0
2: 1
3: 16
4: 141
Right 1083897107 11:65625444-65625466 GCGCAGCTTGGAGACAGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083897104 Original CRISPR AAGCTGCGCTCCTCCAGCTC AGG (reversed) Exonic
900131432 1:1088908-1088930 GAGCTGCGCTCTCCCAGCACTGG + Intronic
900513462 1:3070714-3070736 AAGCTCCGCTCCCTCGGCTCGGG + Intronic
901020680 1:6253809-6253831 AAGCGGCGCTCCTCCATCGATGG - Exonic
901210000 1:7519317-7519339 GAGCTGCCCTCCTCCAGGTCTGG - Intronic
905294868 1:36947775-36947797 AAGCTGTGATGCTACAGCTCTGG - Intronic
906525175 1:46489601-46489623 AATCTCTGCTCCTCGAGCTCTGG - Intergenic
907237490 1:53062230-53062252 CAGCTGCGCTCCGCGGGCTCGGG - Exonic
908113446 1:60919143-60919165 AAGCCCCTCTCCTGCAGCTCAGG + Intronic
912305065 1:108559364-108559386 AAGCTCCGCTTCCCCGGCTCAGG + Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
914162699 1:145149008-145149030 AACCTGCGGTCCTCCTGCACTGG - Intergenic
915355992 1:155255423-155255445 ACGCTCCGCTCCCCGAGCTCCGG + Intronic
915496166 1:156284250-156284272 AAGCTGGGCCCCACCTGCTCTGG + Intronic
917128689 1:171716791-171716813 AAGTTGTGCTCCTCCATCTTGGG + Intronic
919169368 1:193934897-193934919 AGGCTGCGCTCCTGCCACTCTGG + Intergenic
919826259 1:201505717-201505739 AAGCTGCCCTCCAGCAGCTGAGG + Intronic
920698866 1:208202817-208202839 AGGTTGAGCTCCTGCAGCTCGGG - Intronic
921687290 1:218104589-218104611 AACCTCAGCTCCTCCAGTTCAGG + Intergenic
923505321 1:234600299-234600321 AGACTGCGCTGCTCCAGCCCGGG + Intergenic
924434680 1:244028545-244028567 AAGCTGTGGTTCTGCAGCTCTGG + Intergenic
1063894237 10:10662449-10662471 AAGCTGAGATCCTCCAGCACTGG + Intergenic
1064082803 10:12322149-12322171 AATCTGGACTCCTCCTGCTCTGG - Intergenic
1066214874 10:33276548-33276570 ATGCTGTGCTCTCCCAGCTCAGG - Intronic
1075047779 10:119159637-119159659 CAGCTGTGTCCCTCCAGCTCCGG - Intronic
1075098963 10:119492616-119492638 AGGCTGGGCTTATCCAGCTCAGG - Intergenic
1076655887 10:132023014-132023036 AAGCTCCGGTCCTCCAGCCACGG - Intergenic
1079643481 11:22834801-22834823 AAGCTGCGCTGAACCACCTCGGG + Intergenic
1081643151 11:44771447-44771469 ATGGTGGCCTCCTCCAGCTCAGG - Intronic
1082823207 11:57558871-57558893 AAGCTTTGGTCCTCCAGCTCTGG + Intronic
1083715292 11:64571855-64571877 AAGCTGCCTTCCTGCAGCCCTGG - Exonic
1083737883 11:64692016-64692038 TGTCTGAGCTCCTCCAGCTCTGG - Intronic
1083744908 11:64730001-64730023 AAGCCACGCCCCTCCAGCCCCGG - Intronic
1083857585 11:65400775-65400797 AAGATGGGCTCCTCCTCCTCGGG - Exonic
1083897104 11:65625430-65625452 AAGCTGCGCTCCTCCAGCTCAGG - Exonic
1089314553 11:117582698-117582720 AAGCCGGGCCCCTCCAGCTCCGG + Intronic
1089568792 11:119388504-119388526 AAGCTGGGCTGCTCAAGCTGAGG + Intergenic
1089581576 11:119484873-119484895 GTGCTGGGCTCCTCCAGCACAGG - Intergenic
1090766223 11:129878494-129878516 TAGCTGCCCTCTTCCAGCTATGG - Exonic
1101957550 12:109224321-109224343 CACCTGGGCTCCTCTAGCTCTGG - Intronic
1104365567 12:128173439-128173461 AAGCTGCTGTCCTCCAGGGCAGG - Intergenic
1104779932 12:131413566-131413588 ACCCTGGGCTCCTGCAGCTCCGG + Intergenic
1105434425 13:20364422-20364444 AGGCTGCGTTCCTGCTGCTCGGG - Intergenic
1110062802 13:71063483-71063505 AAGCTGCCTTCCTCCTGATCTGG - Intergenic
1114664614 14:24370200-24370222 AAGCGGCGCTATTCCAGCTCGGG + Exonic
1118799035 14:69172297-69172319 AAGCTGCTTTCCTCTATCTCTGG + Intergenic
1119730828 14:76950250-76950272 GAGCTGCATTCCTCCAGCCCCGG - Intergenic
1119890538 14:78179026-78179048 AACCAGCACCCCTCCAGCTCAGG - Intergenic
1120694747 14:87632195-87632217 AACCTGAGCTCCTCCAGTCCAGG + Intergenic
1121081910 14:91115123-91115145 CTGCTGCCCTCCTCCAGCACTGG - Intronic
1121174810 14:91883058-91883080 AAGCTGCACTCGTCCATATCTGG + Exonic
1122320404 14:100852023-100852045 AAGCTGTGCTCCTACTGCTCCGG - Intergenic
1123032190 14:105457118-105457140 AAGCAGCTCCCCTCCAGCCCTGG - Intronic
1127419121 15:58787653-58787675 AAGCTGCGCCTCTCCGGTTCAGG - Intronic
1131056056 15:89375789-89375811 GAGCTGCTTTCCTCTAGCTCTGG + Intergenic
1131283358 15:91038606-91038628 AGTCTCCACTCCTCCAGCTCTGG - Intergenic
1131528993 15:93176328-93176350 CAGCTGAGCTCCTCCCCCTCGGG - Intergenic
1134042732 16:11080858-11080880 AAGATAAGCTCCCCCAGCTCAGG + Intronic
1136171926 16:28495013-28495035 AACCTGGGCTCCTCCAGCCAGGG + Intronic
1140176409 16:72664832-72664854 ACTCCGCGCCCCTCCAGCTCCGG + Intergenic
1140873202 16:79125713-79125735 AAGCTATGTTCCTCCAGATCAGG - Intronic
1142763697 17:2054952-2054974 CATCTGTGCGCCTCCAGCTCAGG + Intronic
1142978599 17:3659049-3659071 AACCTGGGCTCCTCCATCCCCGG - Intronic
1143880609 17:10026789-10026811 AGGATACTCTCCTCCAGCTCTGG + Intronic
1146931146 17:36778806-36778828 CAGCTGCCCTCCTCCAGCACAGG + Intergenic
1147187207 17:38719519-38719541 AAGCTGCAGTCCTCCAGGTCTGG - Exonic
1148240160 17:45995145-45995167 GAGCTGCCCTTCTCCAGGTCTGG + Intronic
1148822496 17:50367693-50367715 AAGCTCCCCTCCTCCCCCTCTGG + Intergenic
1151653969 17:75486839-75486861 GAGCTGGGCTGCTCCATCTCAGG - Intronic
1152372842 17:79901268-79901290 AGGCTGCACTCCTCCAGGGCTGG - Intergenic
1152934087 17:83125942-83125964 AAGCTGGGCTCCACCCGCTCAGG - Intergenic
1153608056 18:6854760-6854782 CAGCTGCCCACCTGCAGCTCTGG + Intronic
1157769387 18:50332313-50332335 CAACTGCACTCCTCCAGCTTGGG + Intergenic
1160220512 18:76974080-76974102 AAAGTCCGCTCCTCAAGCTCAGG + Intergenic
1161038638 19:2098638-2098660 AAGATGCCCGCCTCCAGCTGAGG - Intronic
1161948064 19:7451230-7451252 ATGATGCGCTCCACCAGCACTGG - Exonic
1164995252 19:32716539-32716561 AACCTGCCCTCCTCCAACTCTGG - Intergenic
1166536085 19:43575647-43575669 ACGCAGCGCTCTTCCCGCTCTGG - Exonic
1166673234 19:44723999-44724021 GAGCTGCTCTCCCCAAGCTCCGG + Intergenic
925639571 2:5974581-5974603 AAGCTGTGTTCCACCAGCTCAGG + Intergenic
927040789 2:19228506-19228528 AAGCAGCCTTTCTCCAGCTCAGG + Intergenic
927072469 2:19545259-19545281 AAGCAGTGCTACTCCAGCTATGG - Intergenic
929441161 2:41966766-41966788 AAGCTGCACGCACCCAGCTCTGG - Intergenic
936466095 2:112752234-112752256 AAGATAAGCTCCTCCAGCTTTGG - Intronic
937222809 2:120351842-120351864 CAGCTGCCCACCTCCAGCCCAGG - Intergenic
948299299 2:236890048-236890070 GACCTGCGCCCCTCCAGCTGGGG - Intergenic
948826468 2:240575574-240575596 ACGCTCTGCTCCTTCAGCTCCGG - Exonic
1169057412 20:2635004-2635026 AAGCTCAGCTGCTCCAGCTTTGG - Intronic
1170042891 20:12057013-12057035 CATCTGAGCCCCTCCAGCTCTGG - Intergenic
1170542345 20:17402155-17402177 CAGCTGCACTCCTCCACCACAGG + Intronic
1173798354 20:45878464-45878486 GAGTAGCGTTCCTCCAGCTCTGG - Exonic
1173827310 20:46056261-46056283 AAGCTGCACACCTCCTCCTCTGG - Exonic
1175194300 20:57231780-57231802 AAGCTGGGTTCATCCAGCACTGG - Intronic
1175895328 20:62333425-62333447 AGGCGGCGCTCCTGCAGCTGCGG - Exonic
1176095392 20:63341396-63341418 AAGCTGCGCCCCACCACCTCGGG + Intergenic
1179517017 21:41915365-41915387 AAGCTGGGCTCTTCCAGATTTGG - Intronic
1180165908 21:46028672-46028694 CAGCTGGGTTCCTCCAGCACTGG - Intergenic
1183175544 22:36222422-36222444 AAGTTGCTCTCTTCCAGTTCTGG + Intergenic
1183632651 22:39042714-39042736 AGGCTGACCTCTTCCAGCTCAGG - Intronic
1183924668 22:41197412-41197434 GCGCCGCGCTCCTCCCGCTCTGG + Intergenic
1184996078 22:48208644-48208666 AAGCTGTGCTCCTCCAATGCTGG - Intergenic
1185167846 22:49272649-49272671 CAGTTCTGCTCCTCCAGCTCTGG + Intergenic
1185255725 22:49829555-49829577 ACGCTTCTCTCCTCCACCTCAGG + Intergenic
953407068 3:42664777-42664799 GAGATGCCCTCCACCAGCTCTGG - Exonic
953960612 3:47263250-47263272 CAGCTGAGCACCTCCAGCTTGGG - Intronic
961514286 3:127423067-127423089 AAGGTGGGCACCTCCAGCCCCGG - Intergenic
961814777 3:129543856-129543878 CCTCTGGGCTCCTCCAGCTCTGG - Intronic
962202195 3:133410424-133410446 AAGCCGCGCTCTTCCAGCCCTGG + Intronic
968844316 4:3031476-3031498 GAGCTGCACTCGCCCAGCTCTGG + Intronic
969633795 4:8353570-8353592 AAGCTGCCCTGCCCCAGCACTGG - Intergenic
970768253 4:19577561-19577583 AATCTGCCCACCTCCAGCTGTGG + Intergenic
971175751 4:24280956-24280978 ATGCTGGGCTTCTCCAGCTTTGG - Intergenic
975240114 4:72047345-72047367 ATTCTGCCCTCCTACAGCTCTGG - Intronic
977809065 4:101337751-101337773 AAGCTGCGCTACCCCAGATGTGG - Intronic
978409629 4:108412482-108412504 AAGATGTGCTGCTTCAGCTCAGG - Intergenic
983722864 4:170879134-170879156 AAGCTGAGCTCTTCTAGCTCTGG - Intergenic
985227269 4:187775265-187775287 AAGCTGTGCTCCACCACCTTGGG - Intergenic
994128646 5:96198463-96198485 AAGCAGCGCTCCCCAAGCTGTGG + Intergenic
994910759 5:105903162-105903184 AAGCTGCGCTGCTACAGCTCCGG - Intergenic
996111677 5:119573280-119573302 AAGCTGGGCTCCTCATGCTGGGG + Intronic
997583992 5:135034108-135034130 GCGCTGCGCTCCTGCCGCTCGGG + Exonic
997789541 5:136744888-136744910 AACCTGGGCTGCTGCAGCTCCGG - Intergenic
999269152 5:150286375-150286397 TAGCTGCTCTTCTCCAGCCCTGG - Intronic
1003312105 6:4978388-4978410 AAGCTAAGCTTCTCCAGCTTGGG + Intergenic
1005855948 6:29863586-29863608 AACCTGGGCGTCTCCAGCTCTGG + Intergenic
1006427659 6:33976318-33976340 CAGATCCCCTCCTCCAGCTCTGG + Intergenic
1007348645 6:41251994-41252016 ACTGTGGGCTCCTCCAGCTCCGG - Intergenic
1013619442 6:111873446-111873468 ATGCTCTGCCCCTCCAGCTCCGG + Exonic
1013908502 6:115246295-115246317 AAGCTGAGCTTCTCCAGGTTAGG - Intergenic
1014698303 6:124651750-124651772 ATTCTGCCCTCCTACAGCTCTGG + Intronic
1015832207 6:137382965-137382987 AATCTCCCCTCCTCCAGCACAGG + Intergenic
1018204898 6:161428150-161428172 AAGCCGTGCGCCTCCATCTCAGG + Intronic
1019207311 6:170373199-170373221 AAGCTGAGCTCTTCCTGCTGAGG - Intronic
1019577816 7:1746013-1746035 AGGCCGGGCGCCTCCAGCTCTGG - Exonic
1019720818 7:2569495-2569517 ATGCTGCCCTCCTCCTGCTGAGG - Intronic
1021776236 7:24057919-24057941 AAGCTGCTATCCTCCAGCAAGGG + Intergenic
1022379926 7:29850494-29850516 CTGCTGTGCTCCTCCAGCTCGGG - Intronic
1023487376 7:40701388-40701410 CAGCTTCGCTCCTACAGCACTGG + Intronic
1024563884 7:50665878-50665900 AACCTGTGATCCTCCAGCTGTGG - Intronic
1025940975 7:66076035-66076057 AAGCTTCGGTCCTCCGGGTCTGG - Exonic
1029447315 7:100620993-100621015 CTGCTGCGCTCCAACAGCTCCGG - Exonic
1032739489 7:134724439-134724461 AACCTCAGCTCCTCCAGCTGTGG + Intergenic
1034088255 7:148339693-148339715 AGGGTGCGCTGCTCCAGCCCGGG + Intronic
1036243888 8:7100733-7100755 AATCTGCCCCCCTCCAGCTGGGG - Intergenic
1036775197 8:11606993-11607015 GTGCTGAGCTCTTCCAGCTCTGG - Intergenic
1048658990 8:136575063-136575085 TAGCTGCTCTGCCCCAGCTCTGG + Intergenic
1052316019 9:27117293-27117315 CAGCTGCTCTCTTCCAGCTCTGG - Intronic
1052781013 9:32782642-32782664 AGCCTGCGTTCCTCCCGCTCTGG - Intergenic
1053312815 9:37030073-37030095 AATCGGCGCTACTCCTGCTCGGG - Intronic
1055109828 9:72548885-72548907 ACGATGTGCTGCTCCAGCTCTGG + Intronic
1055934927 9:81595976-81595998 AAGCTGGGCGCCTCCAGGTAAGG + Intronic
1059742380 9:117164649-117164671 AACCTTCGCTGCTTCAGCTCAGG - Intronic
1060545622 9:124457468-124457490 AAGCTCCGCACCTCCAGGCCTGG - Exonic
1060558161 9:124520670-124520692 GAGCTGCTTTCCTCCAGATCGGG - Exonic
1061106720 9:128536438-128536460 ACGCTGCTATCATCCAGCTCCGG + Exonic
1061236204 9:129344061-129344083 GAGCTGGGCTTTTCCAGCTCCGG - Intergenic
1062160295 9:135075999-135076021 AGACGGCGCTCCTCCAGCCCCGG + Intronic
1186096378 X:6107139-6107161 AAACAGAGCTCCTCCAGCTGTGG - Intronic
1189818200 X:44845170-44845192 AAGCTGTGCTCCAGGAGCTCTGG + Intergenic
1199800616 X:151247589-151247611 AAGCAGGGCTTCTCCAGCTAGGG + Intergenic