ID: 1083898174

View in Genome Browser
Species Human (GRCh38)
Location 11:65630699-65630721
Sequence CAGCTTCCCTTGGACAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083898174_1083898178 8 Left 1083898174 11:65630699-65630721 CCTGTTTTGTCCAAGGGAAGCTG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1083898178 11:65630730-65630752 GAGAGTTTAAGTGTCCCCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 121
1083898174_1083898182 28 Left 1083898174 11:65630699-65630721 CCTGTTTTGTCCAAGGGAAGCTG 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1083898182 11:65630750-65630772 AGGTGCCACTGCCAGACCTCAGG 0: 1
1: 0
2: 2
3: 21
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083898174 Original CRISPR CAGCTTCCCTTGGACAAAAC AGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901628468 1:10636457-10636479 CAGCAGCCCGGGGACAAAACTGG + Intergenic
902074331 1:13771060-13771082 CAAATTCCCTTAAACAAAACTGG + Intronic
902943337 1:19815981-19816003 CAGCATGCCTAGCACAAAACAGG - Intergenic
904010849 1:27389454-27389476 CAACTTCCCTTGCAAACAACAGG + Intergenic
907295532 1:53449968-53449990 CAGCTTTTCCTGGACAAAACAGG + Intergenic
907754915 1:57302013-57302035 CACCTTCCTTTTGACAAAAAGGG + Intronic
921281012 1:213568333-213568355 CAGCCTCCCATGGAAAAGACTGG - Intergenic
923122956 1:231010547-231010569 CTTCTTCCCTTGGAGAAAAAAGG - Intergenic
924162090 1:241243629-241243651 CAGCTGCCCTTTAACAAAATAGG + Intronic
924514829 1:244757211-244757233 CAGCTGTCCTTGGACTAGACTGG - Intergenic
1063161696 10:3423268-3423290 GAGCTTTCCTTACACAAAACTGG - Intergenic
1067332341 10:45333856-45333878 CAGCTTCCCTTGGCTAACAGGGG + Intergenic
1067850125 10:49749472-49749494 CAGTTTCCCTAGCTCAAAACAGG + Intronic
1068237527 10:54258179-54258201 CAGCTTCCCTTTGGCTATACAGG - Intronic
1068576494 10:58689676-58689698 CCGCTTTGCTTGTACAAAACTGG - Intronic
1068763569 10:60738142-60738164 CAGCTTCCCTTTAATAAAATGGG - Intergenic
1070502969 10:77088912-77088934 CAGCATCCCTTGGATAACACAGG + Intronic
1073798099 10:107010765-107010787 CAGCTTCCAATGGAGATAACAGG + Intronic
1073907153 10:108295742-108295764 CAACTTCCTTTGGACAATAACGG - Intergenic
1074005946 10:109423488-109423510 CAGCTTCCCTTATATAAAAAAGG - Intergenic
1078790517 11:14537359-14537381 TAAATTCACTTGGACAAAACAGG - Intronic
1079792897 11:24761251-24761273 CAGCTTCACATGGGCAGAACAGG + Intronic
1080637194 11:34134434-34134456 CAGCTTCCCTCAGACACACCAGG - Intronic
1083898174 11:65630699-65630721 CAGCTTCCCTTGGACAAAACAGG - Intronic
1087007000 11:93480682-93480704 CCACTACCCTGGGACAAAACAGG - Intronic
1087072959 11:94099913-94099935 CAGCTTCCCTTGGTCGGAAAGGG + Intronic
1087332106 11:96793456-96793478 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
1087484831 11:98748093-98748115 CAGCTTCCCTTGGCTAAGAAAGG - Intergenic
1088821800 11:113463060-113463082 CTGCTTCCCTGTGAGAAAACGGG + Intronic
1090463865 11:126915566-126915588 CTGTCTCGCTTGGACAAAACTGG - Intronic
1091632822 12:2175051-2175073 CAGCTGACCTTGAACAACACAGG - Intronic
1092208517 12:6631546-6631568 CAGCTTCCCATGTACACATCCGG + Intronic
1094138986 12:27161120-27161142 CATCTTCCCCTAAACAAAACTGG - Intergenic
1095306344 12:40643106-40643128 CAGCTTCCCTTGGCTAGAAATGG + Intergenic
1098703440 12:73657684-73657706 CAGATTCCCTTGTACCAAAAAGG + Intergenic
1099314254 12:81064917-81064939 CAGCTTCTCTTGGCCAAGAAAGG - Intronic
1100199033 12:92278839-92278861 CAGCTTCTCTTTGACAAAAAAGG + Intergenic
1100417122 12:94389706-94389728 CAGCTTCCCTTGGCCAGGAAAGG - Intronic
1100589456 12:96012261-96012283 CAGCTTCTCTTACACTAAACAGG - Intronic
1104044650 12:125153326-125153348 CAGCTTCTCTTGGAATAAAAGGG + Intergenic
1106234863 13:27853186-27853208 CAGTTTCCCTAGGACACAAGAGG + Intergenic
1107965108 13:45590569-45590591 CAGCAGCCCTTGGAGAACACAGG - Intronic
1108719437 13:53116096-53116118 ATTCTTCCCTTGAACAAAACAGG + Intergenic
1109675937 13:65675732-65675754 CAGCTTCCCTTGGCTAGAAAGGG + Intergenic
1112932459 13:104759231-104759253 GAGCTTCCCATGGAGCAAACAGG + Intergenic
1114377966 14:22169638-22169660 CAGGGTCCCTTGGGCAAAGCTGG - Intergenic
1114724181 14:24916982-24917004 CAGCCTGCCATGGACAAAATAGG + Intronic
1115740451 14:36382072-36382094 CAGCTTCCTTTGGCTAAATCAGG + Intergenic
1117725416 14:58668353-58668375 CAGGTTCACTTAGACAAAGCTGG + Intergenic
1117797059 14:59405647-59405669 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
1118071795 14:62253751-62253773 CAGCTTCCCTAGTATAAAATGGG + Intergenic
1118470513 14:66070640-66070662 AAGCTTCCCTTGGAGAAAGCCGG + Intergenic
1119706776 14:76788019-76788041 AAGGTGGCCTTGGACAAAACTGG - Exonic
1121599944 14:95195854-95195876 CATTTTCCCTGGGACAAATCTGG + Intronic
1122504456 14:102222732-102222754 CAGCTCCACGTGGTCAAAACTGG - Intronic
1122684844 14:103497412-103497434 CAGCTTCCCTGGGCAAAAATAGG - Intronic
1123706781 15:22956529-22956551 CAGCATCCCTGGGAGAACACAGG + Intronic
1124215112 15:27800272-27800294 CAGCTTCCATCTGAAAAAACTGG + Intronic
1124286952 15:28409938-28409960 CAGTTTCCCTTCAACAAAATCGG + Intergenic
1124295749 15:28501689-28501711 CAGTTTCCCTTCAACAAAATCGG - Intergenic
1126174021 15:45718953-45718975 CAAGTTCCCTTGGACAAGGCAGG - Intergenic
1129538397 15:76332605-76332627 CAGATTCCCTTTGAGCAAACAGG - Intergenic
1130364825 15:83225465-83225487 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
1131257976 15:90873919-90873941 AAGCTGCCCTTAGACACAACCGG - Intronic
1131929864 15:97429750-97429772 CATCTTCACATGGAAAAAACAGG - Intergenic
1133947024 16:10357163-10357185 CAGCTTGCCTGGGACCAATCAGG + Intronic
1135849619 16:25951250-25951272 CAGCTTCCCTCTGGAAAAACTGG - Intronic
1142125362 16:88407581-88407603 CAGTTTCCCCTGCACAAAACGGG - Intergenic
1144283168 17:13746661-13746683 CATCTTACTTTGGGCAAAACTGG + Intergenic
1144416772 17:15055441-15055463 CAGCTTCCAATGGTCAAAGCTGG + Intergenic
1145960094 17:28882231-28882253 CAGCTTCCTGGGGACAAAAGGGG + Exonic
1152535993 17:80950653-80950675 CAGCTTCCCTGGGACAGGGCAGG + Intronic
1153941590 18:9983044-9983066 CAGCTTCCCTTGGCCAGGAAAGG + Intergenic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1156910257 18:42403603-42403625 CAGCTTCCCTTGGAAAAATCGGG + Intergenic
1157564497 18:48670665-48670687 CAGCTTCCCTTTGCCACACCTGG - Exonic
1157907218 18:51580117-51580139 CAGTTTCTCTATGACAAAACAGG - Intergenic
1158676625 18:59525870-59525892 CATCTGCTCCTGGACAAAACTGG - Intronic
1158962054 18:62595703-62595725 CAGCTTCCCCTGGACACTAAAGG - Intergenic
1160452389 18:78974287-78974309 CAGCCTCCCCTGGGCAAATCCGG + Intergenic
1164072841 19:21784969-21784991 CAGATTCCCTAAGACAAAAATGG - Intergenic
925050028 2:806241-806263 CAGCTTCCCCTGGAAAAGAATGG + Intergenic
925361064 2:3280655-3280677 GAGCTTCCCCTGAACAAAACAGG - Intronic
929629005 2:43439150-43439172 CAGTTTCCCTTGGTCAAACATGG + Intronic
929644942 2:43617091-43617113 CTGTTTCACTTGGACAAGACTGG - Intergenic
931282697 2:60808048-60808070 CTGCTTCCCATGGACAAGAGAGG + Intergenic
932814342 2:74849778-74849800 CAGCTTCCTTGCCACAAAACAGG - Intronic
934157335 2:89215743-89215765 GGGCTCCCCTTGGACAAAATAGG + Intergenic
934209981 2:89967000-89967022 GGGCTCCCCTTGGACAAAATAGG - Intergenic
935226727 2:101059424-101059446 TACCTTCCCTTTGACAAAACTGG + Exonic
939018688 2:136932795-136932817 CAGCTGACCTTGAACAACACAGG - Intronic
939806654 2:146782100-146782122 CAAATTCCCCTGCACAAAACAGG - Intergenic
940720778 2:157279725-157279747 CAGCTTCCCTTGGCTAAGAAAGG + Intronic
943100722 2:183482705-183482727 CAGCTATACTTGGACAAAATAGG - Intergenic
944780168 2:203009492-203009514 CAGTTTCCCTTGGGCAGATCTGG - Intronic
945945135 2:215988303-215988325 CAGCTTCCCTTGGCTAAGAGAGG - Intronic
947343977 2:229171997-229172019 CAACTTTCCTTGGACAGAAAGGG + Intronic
1170494642 20:16913329-16913351 CAGCTTCCCTTGGATAGGAAAGG + Intergenic
1171247217 20:23621241-23621263 CGGCTTCCCTTGGATAAGAAAGG + Intergenic
1172048845 20:32101110-32101132 CAGCTCCCATTGGCCCAAACTGG + Intronic
1173052553 20:39577790-39577812 CATCTGCCATTGGACAAACCTGG + Intergenic
1174052298 20:47775165-47775187 CACCTTCTCTTGGTCAAAACAGG - Intronic
1175785052 20:61707058-61707080 CATCTTCCCTGGGATAAAACAGG + Intronic
1176725078 21:10424916-10424938 CAGCTTCCCTTTCACATGACTGG - Intergenic
1178183604 21:30193404-30193426 CAGCTTCTCTTGGGCAATACAGG - Intergenic
1179332765 21:40421334-40421356 AGGCTTCCCTTTGACAAGACAGG - Intronic
1185107505 22:48882731-48882753 CGGCTTCCCTGGGACATGACGGG - Intergenic
949173945 3:1035359-1035381 CAGCTTCCCTTGGATAGGAGAGG + Intergenic
953389824 3:42527638-42527660 CAGCTTCCCCTGGAGAAGGCAGG + Intronic
955526822 3:59829666-59829688 CAGAGTCCCTTGGCCAGAACTGG - Intronic
958531049 3:95330389-95330411 CAGACTCCCTTGGCCAGAACTGG - Intergenic
958873458 3:99589082-99589104 CAGCTTCCCTTGGCTAGAAAGGG - Intergenic
959170860 3:102842189-102842211 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
959609917 3:108282022-108282044 CAGTTTTCCTTGGACCATACAGG + Intergenic
959845352 3:111026110-111026132 CAGCTTCAGTTCTACAAAACTGG - Intergenic
961621889 3:128230894-128230916 CAGTTTCCCTTGGAGATCACTGG + Intronic
961703975 3:128769752-128769774 CAGCTTCCATTCTACAAAATAGG + Intronic
961994716 3:131229929-131229951 CAGATTCCGTTGGAAAAAAATGG - Intronic
963048519 3:141122850-141122872 CAGCTTCCCTTGGCTAGAAAAGG + Intronic
965651801 3:170941826-170941848 CAGCTTCCAATGGCCAAAGCTGG + Intergenic
966575160 3:181492883-181492905 CAGCTTCCCTTGAAGAATACAGG - Intergenic
966840654 3:184084267-184084289 CAGCTTCCCTTGGCCTCAGCGGG + Intergenic
969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG + Intronic
969058104 4:4414485-4414507 CAGCTGCCCTTGGCCGAAGCTGG + Intronic
971043953 4:22784040-22784062 CAGCTCCCCTTGAATAAATCAGG + Intergenic
972196150 4:36656235-36656257 CAGCTTCCCTTGGCCAGAAAAGG - Intergenic
973291821 4:48478514-48478536 CAGCTTCCTTTCAACAAAAGTGG + Intergenic
974528546 4:63077268-63077290 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
974838027 4:67274110-67274132 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
976263058 4:83164280-83164302 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
976506495 4:85853383-85853405 CAGCTTCCCTTGGCTAAGAAAGG + Intronic
976702479 4:87986057-87986079 GGGCTTCCATTGGCCAAAACTGG + Intergenic
976827713 4:89279090-89279112 CCGATTCCCCTGGACAAGACAGG + Intronic
976984531 4:91276756-91276778 CAGCTAACCTTGGACACAATGGG - Intronic
977425475 4:96862752-96862774 CAGCTTCCCTTGGCTAGAAGAGG - Intergenic
978273855 4:106924915-106924937 CAAGTGACCTTGGACAAAACTGG + Intronic
978694837 4:111565365-111565387 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
979785315 4:124710446-124710468 CTGCTTCCCTTGCAGTAAACTGG + Exonic
979814005 4:125075981-125076003 CAGCTGACCTATGACAAAACTGG - Intergenic
979837799 4:125394901-125394923 CAGCATCCCTTGTAGAAAATAGG - Intronic
980849784 4:138366862-138366884 TACGTTCCCTTGGCCAAAACTGG + Intergenic
986733594 5:10652507-10652529 CAGCTTCCCATGGTGGAAACAGG - Intergenic
987794601 5:22610114-22610136 AAGTTTCCATTGAACAAAACAGG - Intronic
988657633 5:33229538-33229560 CAGCTTCCCGGGCACAGAACTGG + Intergenic
989072161 5:37522721-37522743 CAGCTTCCCTTGGATAGGAAAGG - Intronic
990174116 5:53087975-53087997 CATTTTCCCTTGGACAAGAGTGG - Intronic
991105430 5:62837305-62837327 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
992715227 5:79503935-79503957 CAGATGCCCTTGAACAACACAGG - Intronic
993843268 5:92907450-92907472 CTCCTTACCTTGGACAAATCTGG + Intergenic
993864167 5:93172445-93172467 CAGCTTCCCTTGGCTAGAAAGGG + Intergenic
996100409 5:119439383-119439405 CAGCTTCCCTTGGCTAAGAAAGG - Intergenic
997891233 5:137678808-137678830 CATCTTCCACTGGACAAAAAGGG + Intronic
998541985 5:142991363-142991385 CAGCTTCCCTTGGCCAGGAAAGG + Intronic
999641228 5:153675159-153675181 CAGCTTCCCTTGCAGCCAACTGG - Intronic
999689586 5:154135135-154135157 AATCTTCCTTTGGGCAAAACGGG + Intronic
999832459 5:155333483-155333505 CAGCATGCCTTGGATAAATCAGG + Intergenic
1003228175 6:4225176-4225198 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
1003746132 6:9004552-9004574 CATCTTCCCATGGTCAGAACCGG - Intergenic
1006274960 6:32997022-32997044 GAGCTTCCATTGGCCAAAACTGG - Intergenic
1006844131 6:37050925-37050947 CAGCTGCCCTTGGATATATCAGG - Intergenic
1007907888 6:45481969-45481991 AAGCATCCCTTGGAAACAACAGG + Intronic
1009294681 6:61931695-61931717 CAGTTACCCTTGAACAACACAGG + Intronic
1009619229 6:66051194-66051216 CAGCTTCCCTTGAATTACACAGG + Intergenic
1011251573 6:85377425-85377447 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
1011417720 6:87139894-87139916 CAGCTTCCCTTGGCCAGGAAAGG - Intergenic
1011788312 6:90870345-90870367 CAGCTTCCCTTGGAATTAAGTGG + Intergenic
1013944892 6:115710596-115710618 AAGCTTCCCTTGCAAAAAAATGG - Intergenic
1014701517 6:124694591-124694613 CAGCTGCTCTTGAACAAAGCAGG + Intronic
1016031515 6:139343456-139343478 CAGACTCCCTTGGCCAGAACTGG + Intergenic
1018856566 6:167679111-167679133 CAACTTCCCATGGGCAAAACGGG + Intergenic
1019277637 7:184253-184275 CAGCTTCCCCTGGACAAGAGCGG + Intergenic
1020193755 7:6020856-6020878 CAGCTGCACCTGCACAAAACAGG - Intronic
1025012750 7:55411165-55411187 CAGCTTCCCATGAAAAAACCTGG - Intronic
1028553292 7:92095496-92095518 CCTCTTCCCTAGGAGAAAACAGG - Intronic
1030074941 7:105728853-105728875 GAGCTTCCAGTGGCCAAAACTGG + Intronic
1030166422 7:106560347-106560369 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
1030400736 7:109046444-109046466 CTGGTTTCCTTGGACAATACAGG + Intergenic
1031035217 7:116781188-116781210 CAGTTTCCCTGGGAAGAAACTGG - Intronic
1033404367 7:141057569-141057591 CAGCTTCTGTTGGGCAAACCTGG + Intergenic
1033416693 7:141167836-141167858 CTGCTTCCCTGGGGCACAACGGG - Intronic
1033580123 7:142725507-142725529 CAGCATCCATTGGATAGAACAGG - Intergenic
1034612723 7:152386506-152386528 CAGCTTCCCTTTCACATGACTGG + Intronic
1037557664 8:20041225-20041247 CAGCTTCCCTTGGCTAGGACAGG + Intergenic
1039031907 8:33318360-33318382 CACATTCCCTTGCACAAAAAGGG + Intergenic
1039910068 8:41819509-41819531 CAGCCTCCCTTGGACACATGGGG + Intronic
1040313896 8:46250896-46250918 CAGCTTGCCTGGGACAACACTGG - Intergenic
1040333435 8:46404060-46404082 CAGCTTGCCTGGGACAACCCTGG - Intergenic
1040336091 8:46416744-46416766 CAGCTTCCCCTGGACAGCCCTGG - Intergenic
1040573594 8:48630848-48630870 TAGCTCCCATTGGACAAAGCTGG - Intergenic
1041881875 8:62761107-62761129 CACCTTGCCTTGGACATAACAGG + Intronic
1043284543 8:78513409-78513431 GAGCTTCCAATGGGCAAAACTGG + Intergenic
1043511268 8:80952581-80952603 CAGCTTCCCTTGGCTAAAGGAGG - Intergenic
1044597044 8:93969738-93969760 CAGCTTCCCTTGGATAGGAAAGG + Intergenic
1045341751 8:101261135-101261157 CACATTCACTTGGACATAACAGG + Intergenic
1045542653 8:103101344-103101366 AAGCTTCCCTTGCCCAAAGCAGG - Intergenic
1047641895 8:126829405-126829427 TTGCTTCCTCTGGACAAAACTGG - Intergenic
1048117170 8:131537305-131537327 CAGATTCCTTTGGAAAAGACTGG - Intergenic
1048944426 8:139431194-139431216 CAGTTTCCCCTGGATAAAAGGGG + Intergenic
1055338717 9:75259584-75259606 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
1055785412 9:79864847-79864869 CAGTTTGCCTTGGCCAAATCAGG - Intergenic
1056048153 9:82740459-82740481 CAGCTTCCCTCGCACATAGCTGG - Intergenic
1057301560 9:93888639-93888661 CAGCTTCCAATGGCCAAAGCTGG + Intergenic
1058158243 9:101538904-101538926 CTCCTTCCCTAGGACAAACCAGG - Intronic
1058559081 9:106204279-106204301 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
1061894171 9:133638508-133638530 CAGCTTCGTTTGGACAATTCTGG + Intronic
1186138011 X:6540071-6540093 CACCTTCTCTTGGACATAATTGG + Intergenic
1186405212 X:9295836-9295858 CAGCGACCCTTGAACAACACAGG + Intergenic
1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG + Intronic
1186705431 X:12135679-12135701 CAGCCTCCCTTGGAGACATCTGG - Intergenic
1187790723 X:22947189-22947211 CTGCTTTCCTTGGTCAAGACTGG + Intergenic
1188253338 X:27927528-27927550 CAGCTTCCGTTGACCAAATCTGG - Intergenic
1189206877 X:39248389-39248411 CAGTTCCCTTGGGACAAAACTGG - Intergenic
1190554817 X:51623358-51623380 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
1191788833 X:64946328-64946350 CAGCTTCCCTTGGCTAGAACAGG + Intronic
1192097187 X:68224962-68224984 CAGCTTCCCTTGGCCAGGAAAGG - Intronic
1192226980 X:69236104-69236126 GAGCTTCCAATGGCCAAAACTGG - Intergenic
1192446314 X:71214165-71214187 CAGCTTCCCTTAGCCAAACCTGG - Intergenic
1193001539 X:76568252-76568274 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
1193866863 X:86743282-86743304 CAGCTCTCCTAAGACAAAACTGG - Intronic
1195709571 X:107763342-107763364 CAGATTCCCTTGGATCACACTGG + Intronic
1195746412 X:108123042-108123064 CAGAGTCCCTTGGCCAAAACTGG + Intronic
1201333504 Y:12853442-12853464 CAGCTTCCCTTGGCTAAGAAAGG + Intronic
1201470041 Y:14323041-14323063 CACCTGCCCTTAGCCAAAACAGG - Intergenic