ID: 1083899083

View in Genome Browser
Species Human (GRCh38)
Location 11:65635075-65635097
Sequence GAACCCCAGGCGCCACAACG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083899083_1083899094 12 Left 1083899083 11:65635075-65635097 CCGCGTTGTGGCGCCTGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1083899094 11:65635110-65635132 AGCTTCACCAGGTTGGGGAGGGG 0: 1
1: 0
2: 1
3: 27
4: 255
1083899083_1083899089 6 Left 1083899083 11:65635075-65635097 CCGCGTTGTGGCGCCTGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1083899089 11:65635104-65635126 CCCTCAAGCTTCACCAGGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 107
1083899083_1083899093 11 Left 1083899083 11:65635075-65635097 CCGCGTTGTGGCGCCTGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1083899093 11:65635109-65635131 AAGCTTCACCAGGTTGGGGAGGG 0: 1
1: 0
2: 2
3: 22
4: 245
1083899083_1083899097 30 Left 1083899083 11:65635075-65635097 CCGCGTTGTGGCGCCTGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1083899097 11:65635128-65635150 AGGGGTGTGCCCAGCAGCATGGG 0: 1
1: 0
2: 3
3: 13
4: 225
1083899083_1083899096 29 Left 1083899083 11:65635075-65635097 CCGCGTTGTGGCGCCTGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1083899096 11:65635127-65635149 GAGGGGTGTGCCCAGCAGCATGG 0: 1
1: 0
2: 3
3: 30
4: 307
1083899083_1083899092 10 Left 1083899083 11:65635075-65635097 CCGCGTTGTGGCGCCTGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1083899092 11:65635108-65635130 CAAGCTTCACCAGGTTGGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 305
1083899083_1083899087 5 Left 1083899083 11:65635075-65635097 CCGCGTTGTGGCGCCTGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1083899087 11:65635103-65635125 GCCCTCAAGCTTCACCAGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 87
1083899083_1083899086 1 Left 1083899083 11:65635075-65635097 CCGCGTTGTGGCGCCTGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1083899086 11:65635099-65635121 CATGGCCCTCAAGCTTCACCAGG 0: 1
1: 0
2: 1
3: 17
4: 137
1083899083_1083899091 7 Left 1083899083 11:65635075-65635097 CCGCGTTGTGGCGCCTGGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1083899091 11:65635105-65635127 CCTCAAGCTTCACCAGGTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083899083 Original CRISPR GAACCCCAGGCGCCACAACG CGG (reversed) Exonic
900970351 1:5989199-5989221 GAGCCCCAGGAGCCACCACAGGG + Intronic
900999505 1:6141781-6141803 GAACCCCTGCCGCCACCAGGAGG + Intronic
902560370 1:17273492-17273514 TTACCCCAGGGGCCACACCGGGG + Intronic
915595241 1:156893403-156893425 GTAACCCAGGCCGCACAACGAGG + Intergenic
915812143 1:158924475-158924497 GAACCCCAGCCTCCAGAACTGGG + Intergenic
1062929267 10:1341674-1341696 GAACCACATGCCCCACAGCGGGG + Intronic
1069018963 10:63465200-63465222 GCCGCCCAGGCGCCACAGCGGGG + Intronic
1075441155 10:122480317-122480339 GAACCCCAGTTGCCACATCAGGG + Intronic
1076693669 10:132236802-132236824 GAACCCCAGGCACCAGGTCGAGG - Intronic
1077217985 11:1403036-1403058 GACCCCCCGGGGCCACCACGGGG + Intronic
1081594879 11:44452173-44452195 GAACCCCAGCCCCCACTACCTGG + Intergenic
1083614197 11:64018360-64018382 GAGGCCCAGGGGCCAGAACGGGG - Intronic
1083899083 11:65635075-65635097 GAACCCCAGGCGCCACAACGCGG - Exonic
1096554839 12:52397029-52397051 GAGCCCCAGGCCCCACAAGATGG + Intronic
1103716699 12:122949418-122949440 GAGGGCCAGGGGCCACAACGGGG - Intronic
1104837396 12:131800407-131800429 GGACCCCAAGCGCCATAAGGAGG - Intergenic
1113378009 13:109782531-109782553 CAACCCCAAGCGCCACAACTCGG - Exonic
1118182914 14:63511256-63511278 GAACCCCAGAAGCCACCAAGTGG + Intronic
1123477343 15:20599072-20599094 GAAGCCCAGGCTCCACACTGAGG + Intergenic
1123640673 15:22401310-22401332 GAAGCCCAGGCTCCACACTGAGG - Intergenic
1124233661 15:27968290-27968312 GAATCACAGGTGCCACAAAGGGG + Intronic
1124332420 15:28832143-28832165 CAACCGCAGGCGCCAGAAGGCGG - Intergenic
1125671526 15:41476900-41476922 GAACCCCAGGCCTCACAGGGTGG - Intronic
1132093686 15:98966320-98966342 GAACTTCAGGGGCCACAGCGGGG + Intergenic
1132630061 16:912984-913006 GAGCCCCAGGCACCCGAACGAGG + Intronic
1132734068 16:1376980-1377002 GAACCCCAGGCGTCGCACCTAGG - Intronic
1135629420 16:24024048-24024070 GAACCCCAGGGACCAGAACCAGG + Intronic
1138016783 16:53435188-53435210 GAGACCCAGGTGCCACAACCCGG - Intronic
1145018690 17:19414321-19414343 GAACCCCAGGCTGCAAAAGGGGG + Intronic
1151927704 17:77211037-77211059 GAACAGCAGGCGGCACCACGTGG - Intronic
1152568616 17:81111502-81111524 GTCCCCCAAGCCCCACAACGTGG + Intronic
1158406484 18:57164533-57164555 GCACCCCAGCTGCAACAACGAGG + Intergenic
1160775747 19:854596-854618 GAACCACAGGTGCCACCACGTGG + Intronic
1161349935 19:3785961-3785983 AAACCCCAGCCACCACCACGCGG + Intronic
1161479091 19:4501796-4501818 GAGCCTCAGGTGCCACAACGGGG + Intronic
1164943609 19:32270900-32270922 GAGCCCCAGGCGGCAAAACCAGG + Intergenic
1167081101 19:47276455-47276477 GATCTCCAGGAGCCACAGCGTGG - Intergenic
925391507 2:3497704-3497726 AAATCCCAGGCGCCACATCAAGG + Exonic
945237170 2:207641960-207641982 GAATCCCAGGGGCCACAGCCTGG - Intergenic
1172446448 20:34995937-34995959 GAACCACAGGGGCCATCACGAGG - Intronic
1174334566 20:49849761-49849783 GAAACCCAGGCCCCACAAAGTGG - Intronic
1176132242 20:63501001-63501023 GACCCCGAGGGGCCACACCGTGG - Intergenic
950045557 3:9946852-9946874 GAGCCCCAGGCGCCTGAACTGGG + Exonic
961659234 3:128459582-128459604 GAACCCAGGGAGCCACAACCTGG + Intergenic
962311689 3:134331422-134331444 GAGCCCCAGGCTCCACAGAGGGG + Intergenic
983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG + Intergenic
992342942 5:75844812-75844834 GAAGCCCAGGCCACACAAAGAGG - Intergenic
996267586 5:121561221-121561243 CAACCCCAGGCAGCACAACCTGG + Intergenic
999811481 5:155131509-155131531 GAACCCCAGGCTCCAGAAGCAGG - Intergenic
1000253846 5:159519615-159519637 GAAGCCCAGGCCCCACAGAGAGG - Intergenic
1001837284 5:174843088-174843110 GAAGCCCAGAGGCCACAAGGAGG + Intergenic
1003192557 6:3887421-3887443 GAGCCCTAGGGGGCACAACGTGG - Intergenic
1024199981 7:47096776-47096798 GAAGCCCAGGGGGCACAAGGTGG - Intergenic
1024922066 7:54568594-54568616 GAACAGCAGGCTCCTCAACGAGG - Intronic
1027400213 7:77798871-77798893 GAGCCCAAGGAGCCACAACGAGG - Exonic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1037742140 8:21616391-21616413 GACCCCCAGGGGCCACAGGGAGG + Intergenic
1056560198 9:87723225-87723247 GAACCCCATTCGCCACCAGGAGG - Intergenic
1056595765 9:88006796-88006818 GAACCCCAAACCCCCCAACGCGG + Intergenic
1203490033 Un_GL000224v1:96050-96072 TGACCCCAGGCGCCACCAGGAGG + Intergenic
1203502656 Un_KI270741v1:37933-37955 TGACCCCAGGCGCCACCAGGAGG + Intergenic
1195280458 X:103328190-103328212 GAACCCCAGGCTGCACAGCTTGG + Intergenic