ID: 1083899327

View in Genome Browser
Species Human (GRCh38)
Location 11:65636167-65636189
Sequence ACAGCCCTTGTGAAGCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 146}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083899327_1083899340 29 Left 1083899327 11:65636167-65636189 CCCCCAGGCTTCACAAGGGCTGT 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1083899340 11:65636219-65636241 GGATGATTCAGACTGTAGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1083899327_1083899338 27 Left 1083899327 11:65636167-65636189 CCCCCAGGCTTCACAAGGGCTGT 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1083899338 11:65636217-65636239 GTGGATGATTCAGACTGTAGTGG 0: 1
1: 0
2: 0
3: 27
4: 92
1083899327_1083899334 0 Left 1083899327 11:65636167-65636189 CCCCCAGGCTTCACAAGGGCTGT 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1083899334 11:65636190-65636212 GGCGCCGGCTGCAATAGTGGCGG 0: 1
1: 0
2: 1
3: 4
4: 71
1083899327_1083899337 8 Left 1083899327 11:65636167-65636189 CCCCCAGGCTTCACAAGGGCTGT 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1083899337 11:65636198-65636220 CTGCAATAGTGGCGGGAACGTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1083899327_1083899341 30 Left 1083899327 11:65636167-65636189 CCCCCAGGCTTCACAAGGGCTGT 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1083899341 11:65636220-65636242 GATGATTCAGACTGTAGTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 136
1083899327_1083899339 28 Left 1083899327 11:65636167-65636189 CCCCCAGGCTTCACAAGGGCTGT 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1083899339 11:65636218-65636240 TGGATGATTCAGACTGTAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 116
1083899327_1083899335 1 Left 1083899327 11:65636167-65636189 CCCCCAGGCTTCACAAGGGCTGT 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1083899335 11:65636191-65636213 GCGCCGGCTGCAATAGTGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 49
1083899327_1083899333 -3 Left 1083899327 11:65636167-65636189 CCCCCAGGCTTCACAAGGGCTGT 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1083899333 11:65636187-65636209 TGTGGCGCCGGCTGCAATAGTGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083899327 Original CRISPR ACAGCCCTTGTGAAGCCTGG GGG (reversed) Exonic
900483506 1:2910646-2910668 ACAGGGCTTGGGTAGCCTGGGGG - Intergenic
900970545 1:5990233-5990255 ACAGCCCTGGTGAAGCGTGGTGG - Intronic
909166698 1:72235279-72235301 AGAGCGCTTGTGAAGAGTGGTGG + Intronic
913048191 1:115090704-115090726 TTAGCCCGAGTGAAGCCTGGTGG + Intergenic
914371689 1:147030989-147031011 ACAGCCCTTCTGAGGTCTGATGG - Intergenic
915558105 1:156671010-156671032 GCAGCCCCTGGGGAGCCTGGAGG + Exonic
916518968 1:165546108-165546130 ACACCCATTGGGAAGCCAGGAGG - Intronic
916765729 1:167858625-167858647 ACAGCCTTACAGAAGCCTGGTGG + Intronic
917083325 1:171279570-171279592 AAAACCCTTGAGAAGCCTGAAGG - Intronic
917970902 1:180206846-180206868 CCAGCCCTGGTGAAGCTTAGAGG - Intergenic
920055595 1:203188711-203188733 ACTGCCCTTGTGAGACCTGAGGG - Intergenic
920268566 1:204745461-204745483 ACAGCACTGGAGAAGACTGGGGG - Intergenic
920660151 1:207908620-207908642 ACAGGCCTTGGAAAGCTTGGAGG + Intronic
1064598456 10:16969847-16969869 AGAGATCATGTGAAGCCTGGTGG + Intronic
1066229481 10:33418465-33418487 ACAGCCCTAGAGTAGCCTTGAGG - Intergenic
1069430445 10:68330384-68330406 ACAGACATTGGGAAGCCTGTTGG - Intronic
1069919463 10:71807734-71807756 TCAGCCTTGGTGAAGCGTGGTGG - Exonic
1070844209 10:79508509-79508531 ACAGCACATGAAAAGCCTGGAGG - Intergenic
1070929589 10:80251803-80251825 ACAGCACATGAAAAGCCTGGAGG + Intergenic
1078098067 11:8312626-8312648 ACAGCCCCTGTTAACCCTTGTGG - Intergenic
1080474494 11:32577041-32577063 GCAGCCATTTTGCAGCCTGGTGG - Intergenic
1081498826 11:43645007-43645029 ACAGCACCAGGGAAGCCTGGGGG - Intronic
1083631643 11:64098357-64098379 ACAGCCTATGTGAAGACTGGAGG - Intronic
1083899327 11:65636167-65636189 ACAGCCCTTGTGAAGCCTGGGGG - Exonic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089613018 11:119680136-119680158 ACAACCCATGTGGAGACTGGAGG - Intronic
1090227986 11:125083025-125083047 TCAGCCCTGGTGGAGCTTGGAGG - Intronic
1090285327 11:125495205-125495227 CCAGCCATTGTGCTGCCTGGAGG - Exonic
1090701041 11:129296054-129296076 ACAGGCCTCCTGATGCCTGGTGG + Intergenic
1091315821 11:134613395-134613417 ACAGCCCCTGTGCAGTCTTGAGG + Intergenic
1091776753 12:3189695-3189717 CCAGCCCGTCTGAAACCTGGAGG - Intronic
1092078348 12:5691973-5691995 CCAGATCTTGTGAGGCCTGGTGG + Intronic
1092444786 12:8544518-8544540 AAAGCCCTTGTAAAGCCCTGTGG - Intergenic
1093979749 12:25463289-25463311 ACAAACCAGGTGAAGCCTGGAGG - Intronic
1094425813 12:30316104-30316126 ACAACAGTTCTGAAGCCTGGAGG + Intergenic
1096314477 12:50552022-50552044 AGAGCCCTTGTGCATGCTGGTGG - Intronic
1096474334 12:51898976-51898998 ACAGCCTATGGGAAGCCTGCAGG + Intergenic
1096535646 12:52270962-52270984 CCTGACCTTGTGCAGCCTGGTGG + Intronic
1097717168 12:62979344-62979366 AAAGACCTTGTGAAGACAGGAGG - Intergenic
1102245443 12:111353016-111353038 ACAGCTCTTGAGAAGGTTGGAGG + Intergenic
1103662707 12:122534219-122534241 CCAGCCAGTGGGAAGCCTGGTGG - Intronic
1104342387 12:127962920-127962942 AAAGTCCTTGTGGAGGCTGGTGG - Intergenic
1104735456 12:131133461-131133483 GCAGCTCTTGTGAAGGCTCGAGG + Intronic
1105566667 13:21555934-21555956 ACAGTCCTTGTGAAGACAAGAGG - Intronic
1106128563 13:26920985-26921007 CCAGCCTCTGGGAAGCCTGGGGG - Intergenic
1108184689 13:47876984-47877006 ACATCCCTTGTGATGCCTTGTGG + Intergenic
1113897886 13:113777382-113777404 ACAGTGCCTGTCAAGCCTGGTGG + Intronic
1114393232 14:22332468-22332490 ACAGCCCTAGTTAGGCCTGAGGG - Intergenic
1114893888 14:26961364-26961386 ACAGGCATTTTGGAGCCTGGAGG + Intergenic
1115396999 14:32919766-32919788 ACAACCCTTGGGAAGCCTGCAGG + Intergenic
1117343746 14:54813167-54813189 CCAGCCCTTGTGCAACCAGGAGG + Intergenic
1118801176 14:69191490-69191512 ACGGCCCTAGTGAATCCGGGTGG + Intronic
1120945938 14:89997108-89997130 ACATCACTTCTGGAGCCTGGTGG + Intronic
1121307481 14:92916164-92916186 AGAGCTCTTGTGAGGCCTCGTGG - Intergenic
1121763071 14:96462061-96462083 ACAGGCCCTCTGGAGCCTGGGGG - Intronic
1127261704 15:57331421-57331443 ACAGCCACTGTGAAGACTGGGGG + Intergenic
1140831642 16:78757045-78757067 GCAGCCCTAGTTAAGCCTTGAGG + Intronic
1141450006 16:84092891-84092913 AGAGGCCTGGGGAAGCCTGGAGG + Intronic
1141890132 16:86920735-86920757 ACTGCCCAAGTCAAGCCTGGAGG - Intergenic
1141979679 16:87542172-87542194 ACAGTCCTTCTGCAGCCTGAAGG + Intergenic
1144722450 17:17480885-17480907 GGAGACCTCGTGAAGCCTGGGGG + Intronic
1155097512 18:22572423-22572445 AGAACCTTTGTGAACCCTGGGGG - Intergenic
1156233990 18:35183382-35183404 ACACCCCGTGTGAAGCCCTGAGG + Intergenic
1156297892 18:35809197-35809219 ATGGCCCATGGGAAGCCTGGTGG - Intergenic
1157289245 18:46398396-46398418 ACAGCCCTGATGAAGGCTCGGGG - Intronic
1157661253 18:49447148-49447170 ACAGCACGTGTGAAGCCCTGTGG + Intronic
1160420578 18:78741123-78741145 TCAGCCCCTGTGCAGCCTGGGGG - Intergenic
1165783917 19:38449844-38449866 ACAGCTCGTGTGAGGCCTTGTGG + Intronic
1166233642 19:41440706-41440728 AGAGCCATTGTGAAGTCTTGTGG + Intronic
1166893302 19:46007889-46007911 GCAGCCCTGGTGTAGTCTGGGGG - Intronic
925100536 2:1241014-1241036 ACAGCCTTTATCAAGGCTGGTGG + Intronic
926104764 2:10143207-10143229 ACAGCCTGTGTGAAGGCAGGAGG - Intronic
927193863 2:20534597-20534619 ACAGCATTTGTGAAGGCTGGAGG + Intergenic
931034445 2:58222343-58222365 AGAGCCATAGTGAAGCCTTGAGG - Intronic
932284495 2:70520811-70520833 ACAGGCCTTGTGGAGAGTGGTGG - Intronic
937428408 2:121818259-121818281 GCAGCACTTGTGATGGCTGGAGG - Intergenic
937972377 2:127560590-127560612 ACAGGCCTTGAGAAGCCTGGCGG + Intronic
938958026 2:136316805-136316827 ACAGACCTTGTAAAGCCTGAGGG - Intergenic
939869767 2:147514070-147514092 ACAGCACCTGTGAAGCTTGCAGG + Intergenic
946896878 2:224333073-224333095 TCAGCACTTGGGAAGGCTGGTGG + Intergenic
949060930 2:241956888-241956910 ACAGCCCTGGCGTACCCTGGTGG + Intergenic
1171191712 20:23163692-23163714 AAACCCCTTCTGCAGCCTGGGGG + Intergenic
1176001359 20:62832837-62832859 ACAGCCCTTGGGAGACCTGCAGG - Intronic
1176215349 20:63945180-63945202 AGAGGCCTTGTGGAGGCTGGGGG + Intronic
1178295769 21:31409000-31409022 ACCGCACTGATGAAGCCTGGAGG - Intronic
1179116569 21:38498765-38498787 GCAGCCCGTGTGAAGCCATGCGG - Intronic
1180212238 21:46301939-46301961 ACAGCCCTGAGGAAGCCTGGGGG + Exonic
1182892742 22:33832515-33832537 ACAGCTTGCGTGAAGCCTGGGGG - Intronic
1182895421 22:33855501-33855523 ACAGCCCTGGTGAGGCGTGATGG - Intronic
1183447065 22:37864483-37864505 ACAGCAGCTGTGTAGCCTGGGGG + Intronic
1183654584 22:39177268-39177290 TCTGCCCTTGGGGAGCCTGGAGG + Intergenic
1183774963 22:39958071-39958093 ACAGCCCATGGGGAGCCTGGTGG - Intronic
952172150 3:30818986-30819008 CCAGCCATTCTGAAGCCTGCAGG + Intronic
952962291 3:38600013-38600035 ACAGCCCTGGTGAAGGGAGGTGG + Intronic
953038985 3:39238056-39238078 GAAGTCCTTGTGAAGGCTGGTGG + Intergenic
956876743 3:73471304-73471326 ACGTTCCTTGTGAAACCTGGGGG - Intronic
958445174 3:94206261-94206283 ACAGTCCTTGTGAAGGATGCTGG - Intergenic
961507392 3:127379077-127379099 ACAGGCCTTGTAAGGCCTGGAGG + Intergenic
965935188 3:174100649-174100671 GCAGCCTATGTGAAGCCTGGTGG - Intronic
969245732 4:5931649-5931671 GCAGCCCTTGTGATGTCTGACGG + Intronic
969371572 4:6734539-6734561 ACAGCTCTTGTCAAGGCTTGGGG - Intergenic
969842402 4:9892117-9892139 ACAGCCCATGCTAAGCTTGGGGG - Intronic
977902660 4:102440091-102440113 CCAGGCATTGTCAAGCCTGGAGG + Intergenic
978375904 4:108075412-108075434 ACAACCCTTGTGAAACATAGAGG - Intronic
979471748 4:121107208-121107230 ACAGCACTTGCCAAGCCTTGAGG + Intergenic
984587809 4:181582764-181582786 GCAGTCCTTGTGCAGCCTGGCGG - Intergenic
985246881 4:187987966-187987988 ATAGACCTTGTAAAACCTGGAGG + Intergenic
985804445 5:2031917-2031939 CCAGCCCTGGAGAAGCCTTGTGG + Intergenic
985809899 5:2075274-2075296 TCTGCCCTTGTGAGGCCTTGAGG + Intergenic
987208045 5:15647934-15647956 ACTGCCTCTGTGAAGCCTGGGGG + Intronic
996880165 5:128287994-128288016 ACCGCCCTTCTGAGGCCTGAGGG + Intronic
998037673 5:138930673-138930695 GTAGCCCCTGTGCAGCCTGGTGG - Intronic
998355014 5:141527916-141527938 GCATACCTTGTGAAGGCTGGAGG - Intronic
1001740719 5:174050888-174050910 ACAGCCCTGGGGAGGCTTGGGGG - Intronic
1003489985 6:6613283-6613305 TCAGCCCTTGTGCAGTCTAGGGG + Intronic
1005465545 6:26109058-26109080 ACAGCACTTCGGAAGGCTGGAGG + Intergenic
1006608669 6:35278720-35278742 CCAACACTTGTGAAGCCTGCAGG - Intronic
1008493333 6:52108221-52108243 ATTGCCCTTGAGAAGCCTTGAGG - Intergenic
1008618345 6:53247359-53247381 ACGGCACTTGTAAAGGCTGGAGG - Intergenic
1015487463 6:133789012-133789034 ACAGCCTTTGTGAACCCAGGTGG + Intergenic
1018920319 6:168167996-168168018 ACAGCCCCTGTCACCCCTGGAGG - Intergenic
1019122360 6:169813319-169813341 CTAGGCCTTGCGAAGCCTGGTGG - Intergenic
1019368868 7:650435-650457 GCAGCCGGTGTGAAGGCTGGAGG - Intronic
1019659729 7:2217433-2217455 AGAGCTGGTGTGAAGCCTGGAGG + Intronic
1020406464 7:7840862-7840884 ACAGTTGTTGTGAAGCTTGGAGG + Intronic
1022517165 7:30983469-30983491 GCAGCCATTGTGAAACCTGTAGG - Intronic
1023759163 7:43447679-43447701 TCTGCTGTTGTGAAGCCTGGTGG - Intronic
1024115868 7:46192503-46192525 ACTCCCCTTGGGAAGCCTGCTGG + Intergenic
1024511802 7:50210390-50210412 ACAGCCCTTGTAATGCAGGGTGG - Intergenic
1024596309 7:50940579-50940601 AGAGCCCTGCTGAAGCCTGCGGG - Intergenic
1026322640 7:69280868-69280890 AAAGCCTTTGTAAAGGCTGGTGG + Intergenic
1026470143 7:70688100-70688122 ACAGCTACTGAGAAGCCTGGAGG - Intronic
1027144986 7:75688230-75688252 ACCGCCCTTGTGAAGCCACCAGG + Intronic
1033250281 7:139752788-139752810 ACAGCCCTGCTGAAGCATGAGGG + Intronic
1034436118 7:151063458-151063480 CCAGCCCATCTGCAGCCTGGAGG - Intronic
1034493296 7:151405762-151405784 AGACTCCCTGTGAAGCCTGGCGG - Intronic
1035386246 7:158474982-158475004 ACAGGCCCTGAGGAGCCTGGTGG + Intronic
1035649961 8:1256884-1256906 ACAGGCCTTGTGAATGGTGGTGG + Intergenic
1035909044 8:3545392-3545414 ACAGCCATTGTGATGTCTGATGG + Intronic
1037880906 8:22572957-22572979 AGAGGCCATGTGAAGCCTGGTGG - Intronic
1037895675 8:22652576-22652598 ACTGCCCTAGTGAAGTCGGGAGG - Intronic
1040404510 8:47086907-47086929 CCAGCTCATGTGGAGCCTGGAGG - Intergenic
1040435551 8:47387447-47387469 ACAGCCATTGTGGTGCCAGGTGG + Intronic
1042501420 8:69513665-69513687 AAAGCCCTTGTGAATCCCAGGGG + Intronic
1049431329 8:142566662-142566684 CCAGCCCTTTGGGAGCCTGGTGG + Intergenic
1051501692 9:17785099-17785121 ACAGCACATGTAAAGGCTGGTGG - Intronic
1052667397 9:31512952-31512974 ACAGCCCTTGTAAAGGCCAGTGG - Intergenic
1056238895 9:84623660-84623682 ACAGCCATTGTGAAGCCATGTGG - Intergenic
1059329514 9:113525964-113525986 TCAGCCCTGCTGAAGCCTAGGGG - Intronic
1059539780 9:115118626-115118648 AAAGCCCTTCAAAAGCCTGGGGG + Intergenic
1059609748 9:115879583-115879605 CCAGCCCTTGGCAATCCTGGAGG + Intergenic
1060444173 9:123672196-123672218 ACAGCTGTAGTGAAGCCAGGAGG - Intronic
1061319026 9:129816061-129816083 GCAGACCGTGGGAAGCCTGGCGG - Intronic
1061489239 9:130936121-130936143 ACAGCCCTTGTGAAATGAGGAGG + Intronic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1185835393 X:3341966-3341988 AAAGCCCATTTGAATCCTGGGGG - Intronic
1187111423 X:16304877-16304899 CTAGCACTTTTGAAGCCTGGAGG + Intergenic
1188874888 X:35417543-35417565 ACAGCACTTTTGGAACCTGGGGG - Intergenic
1189196882 X:39160763-39160785 ACAGCCACTGAGAAGCCTGTGGG - Intergenic
1190896231 X:54620853-54620875 ACAGCCATTGTGAAACCATGAGG - Intergenic
1192144172 X:68669840-68669862 ACTGCCCTTGTGAGCCTTGGAGG - Intronic
1192535687 X:71925294-71925316 ACAACCCTTGAGGAGTCTGGTGG - Intergenic
1194959507 X:100218899-100218921 ACAGTTCATGTGAAGGCTGGAGG - Intergenic
1197267691 X:124392963-124392985 GCTGCCCTTGTGAATGCTGGGGG - Intronic
1198836955 X:140815823-140815845 ACAGCCCCTGTGAAGGATGGGGG + Intergenic
1200230838 X:154443175-154443197 CCAGCCCTTGCCCAGCCTGGGGG + Exonic