ID: 1083901761

View in Genome Browser
Species Human (GRCh38)
Location 11:65646752-65646774
Sequence TGAGCCCGCTGCCTGCAGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 221}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083901761_1083901771 14 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901771 11:65646789-65646811 GCGCGCGGCGCCCGGGGCGCGGG 0: 1
1: 1
2: 13
3: 140
4: 757
1083901761_1083901775 25 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901775 11:65646800-65646822 CCGGGGCGCGGGTCGCCGCCGGG 0: 1
1: 0
2: 2
3: 34
4: 272
1083901761_1083901768 7 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901768 11:65646782-65646804 GGGGAGTGCGCGCGGCGCCCGGG 0: 1
1: 1
2: 2
3: 19
4: 282
1083901761_1083901773 24 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 283
1083901761_1083901769 8 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901769 11:65646783-65646805 GGGAGTGCGCGCGGCGCCCGGGG 0: 1
1: 0
2: 1
3: 38
4: 358
1083901761_1083901767 6 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901767 11:65646781-65646803 TGGGGAGTGCGCGCGGCGCCCGG 0: 1
1: 0
2: 1
3: 17
4: 183
1083901761_1083901776 26 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901776 11:65646801-65646823 CGGGGCGCGGGTCGCCGCCGGGG 0: 1
1: 0
2: 3
3: 56
4: 335
1083901761_1083901766 -1 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901766 11:65646774-65646796 ACTGGTGTGGGGAGTGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 181
1083901761_1083901770 13 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901770 11:65646788-65646810 TGCGCGCGGCGCCCGGGGCGCGG 0: 1
1: 1
2: 9
3: 66
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083901761 Original CRISPR TGAGCCCGCTGCCTGCAGCT CGG (reversed) Exonic