ID: 1083901773

View in Genome Browser
Species Human (GRCh38)
Location 11:65646799-65646821
Sequence CCCGGGGCGCGGGTCGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083901761_1083901773 24 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083901773 Original CRISPR CCCGGGGCGCGGGTCGCCGC CGG Exonic
900113835 1:1020418-1020440 CCTGGGGCGGGGGTCCCGGCGGG - Intronic
900382574 1:2392074-2392096 GTCGGGGCCCGGGTGGCCGCGGG + Intronic
900786693 1:4654441-4654463 GCGGGGGCCGGGGTCGCCGCGGG - Intergenic
900985079 1:6068632-6068654 CCCGGGGCGGGGGTGCCCGATGG - Intronic
901280037 1:8026600-8026622 GCCGAGGCCCGGGTCGCCGCGGG - Intergenic
901489326 1:9588799-9588821 CCGGGGGCGCGGGCCGCAGGCGG - Intergenic
902385523 1:16073471-16073493 CCCGGGGTGCGTGGGGCCGCGGG + Exonic
903219985 1:21864184-21864206 CCCGGTGCGCGTGTAGCCGGGGG + Exonic
903250973 1:22052936-22052958 GCCGGGGCGGGGGTCGCGGCCGG + Intronic
903349901 1:22711154-22711176 CGCCGGGCGCAGGTGGCCGCGGG + Intronic
904942883 1:34177303-34177325 CTCGGGGGGCGGGGCCCCGCAGG - Intronic
905202149 1:36322595-36322617 CCCGGGGCCCGGCTCAGCGCCGG - Exonic
905390993 1:37635109-37635131 CCCGGGGCGCGGGGAGGGGCAGG - Intergenic
907051191 1:51330668-51330690 GCGGGAGCGCGGGTCGCCGCGGG - Intronic
908132025 1:61083246-61083268 CCCGGGGAGGGGGCCGCCGACGG + Intronic
908738926 1:67307738-67307760 GCCGGGGCGGGGGTCGGGGCTGG - Exonic
910251321 1:85201343-85201365 CCCGGGGCGCGGGTCCCCGGAGG - Intergenic
910760819 1:90729617-90729639 GCAGGGCCGCGGGTCACCGCAGG + Intergenic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
913714438 1:121519502-121519524 CGCGAGGCTCGGGTCCCCGCGGG + Intergenic
919097820 1:193059092-193059114 CGCGGGGCGGCGGTGGCCGCAGG + Intronic
919764016 1:201114899-201114921 CCCGGTGCCCGGGAGGCCGCGGG + Exonic
923007884 1:230066977-230066999 GCCGGGGCGCGGGCCGCGGGAGG - Intronic
923684000 1:236142032-236142054 CCCGAGGCGCGGGGCGCGGCTGG + Intergenic
924042604 1:239998051-239998073 CCCGGGTCGGCGGTGGCCGCGGG - Intergenic
924436360 1:244047837-244047859 ACCTGGGCGCGGGACGCCGCAGG + Intergenic
1062874162 10:931736-931758 CGCGAGGCGCGGGTCCGCGCGGG - Intergenic
1062890476 10:1056480-1056502 CCCGGGGCGCGGTCCGCCTGAGG - Intronic
1063452935 10:6163641-6163663 CCCGGGGCCCGGGACCCAGCTGG - Intronic
1064354247 10:14603849-14603871 CGCGGGGCGAGGGGCGCCGAGGG + Intronic
1064645321 10:17454116-17454138 CGCGCGGCGCGGGGCGCGGCCGG + Intronic
1064860323 10:19817949-19817971 CCCGGGGCGCAACTCCCCGCAGG - Intronic
1065115219 10:22477438-22477460 CCCAGGGCCTGGGCCGCCGCAGG - Intergenic
1066429378 10:35336980-35337002 AGCGGGGCGCGGGTGGACGCGGG - Exonic
1068544976 10:58335128-58335150 TCAGGGGCGTGGGTCGTCGCGGG - Exonic
1069158094 10:65054062-65054084 CACGGAGCGCGGGTAGCAGCCGG - Intergenic
1070333024 10:75431468-75431490 GTCGGGGCGCGGGGCGCTGCGGG + Intronic
1071309458 10:84328833-84328855 GCCGGGGCCGGGGTCGCGGCGGG + Intronic
1073249840 10:102114665-102114687 CCTGGGGGGCGGGGGGCCGCGGG + Intronic
1074618305 10:115092937-115092959 CCCGGGGCGCGGGGTGCGGGTGG + Intergenic
1075616061 10:123891661-123891683 CCCTGGGCGCGGGGCGGAGCAGG - Exonic
1075697775 10:124448885-124448907 CCTGGGGCCCGGGGCGCCTCTGG - Intronic
1076639008 10:131901337-131901359 CCCGGGGCGGGGCGCGGCGCGGG - Intronic
1076721970 10:132396833-132396855 CCCGGGGCTCCGGCCGCGGCGGG + Intergenic
1076792859 10:132786055-132786077 CGCGGGGCGCGGGGCGCGGGGGG + Intergenic
1076821552 10:132942367-132942389 CCCGGGGCGGGGGTCGTGGCGGG + Intronic
1076821571 10:132942402-132942424 CCCGGGGCGGGGGTCGTGGCGGG + Intronic
1077020888 11:416765-416787 CCCAGGGCGCAGGTGGGCGCGGG - Intronic
1077224348 11:1433607-1433629 CCCGGGGCAGGGGTCCCTGCAGG - Intronic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1077524797 11:3057548-3057570 TCCGGAGCGCGGGTCGCCATTGG - Intronic
1078800895 11:14643631-14643653 GCCGCGGCGCGGGTGGCGGCGGG + Intronic
1081937975 11:46918087-46918109 GCCGGGGCGCGGGTCTGGGCCGG - Intronic
1083607391 11:63986894-63986916 CTCACGGCGCGGGCCGCCGCTGG - Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1084086305 11:66856905-66856927 CCCGAGGCCCGGGCCGGCGCGGG - Intronic
1084438475 11:69157476-69157498 CCTGGGGGGCGGGAGGCCGCCGG - Intergenic
1089622234 11:119728728-119728750 TCCGGGCCCCGGGCCGCCGCCGG + Exonic
1090736910 11:129618239-129618261 GGCGGGGCGCGGGGCGCAGCTGG - Intergenic
1090799137 11:130159886-130159908 CGCGGGGCGCGGGGCGCAGGCGG - Exonic
1091434143 12:460295-460317 CCCTGGGCGCGGGGCCCGGCCGG + Intergenic
1091616082 12:2052564-2052586 CGCGGGGGGCGCGACGCCGCCGG + Intronic
1092219122 12:6700756-6700778 CCTGGGGCGCGGGGCGGCGGCGG + Intronic
1093164376 12:15788921-15788943 CCCTGGGCGCGGGTCTGCACGGG + Intronic
1095949354 12:47773445-47773467 CCCGGGACGCTGGGCGGCGCGGG + Intronic
1095958306 12:47819067-47819089 CGCGGGAAGCGGGGCGCCGCAGG - Intronic
1098991196 12:77065931-77065953 CCCCGGGCGCGGCAAGCCGCGGG - Intergenic
1102913767 12:116737926-116737948 GCCGGGGCGCGGAACGCGGCAGG + Exonic
1103604714 12:122078426-122078448 CCCGGGGCGCGGAGCGGGGCGGG + Intergenic
1103698582 12:122835747-122835769 CCAGGGGCGGGGGACGGCGCGGG + Intronic
1103905788 12:124326646-124326668 CCTGGGGCTGGGGTCGCTGCAGG - Intronic
1104001540 12:124863668-124863690 GCCGGGGCGCTGGGCGTCGCGGG - Exonic
1104756524 12:131273109-131273131 CCAGGGGGGCCGGTCTCCGCCGG + Intergenic
1104866987 12:131961526-131961548 CCCGGGGCTGGGGGCGCAGCGGG + Exonic
1104885536 12:132104894-132104916 CCCGGGGCTGGGGGCGCAGCGGG + Exonic
1104983308 12:132583365-132583387 CCCGGGGCGGGGGCGGCAGCGGG - Exonic
1105557364 13:21459419-21459441 CGCGGGCCGCGGGCCGCCCCCGG + Intergenic
1106555155 13:30803104-30803126 CCCAGGGCGCGGGAGCCCGCAGG - Intergenic
1107468031 13:40666657-40666679 GCCGGCGCGCGCGCCGCCGCGGG - Intergenic
1109915885 13:68984784-68984806 CCTGGGCCGCGTGTCGCCCCTGG - Intergenic
1112503020 13:99956749-99956771 CCCGCGGCCCGGGTCCCAGCGGG - Intergenic
1113541792 13:111115190-111115212 CGCAGGGCGCGGGGCGGCGCGGG + Intronic
1114483253 14:23048058-23048080 CGCGGGGCCGGGGGCGCCGCCGG + Exonic
1117157092 14:52951439-52951461 CCCGGGGCGCTGGTGGCCGGCGG + Intronic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1118293742 14:64549910-64549932 CCCGGGGCGCGGAGCGGGGCGGG - Exonic
1118797169 14:69153504-69153526 GCCGGCCCGCGGGTCCCCGCGGG - Intergenic
1118854741 14:69611999-69612021 CCAGCGGCGCGGCTCGCGGCCGG - Intronic
1121014259 14:90538852-90538874 GCCGGGCCCCGGGTCACCGCTGG - Exonic
1122418228 14:101560521-101560543 ACCCGGGCGCGGGGCGCCACGGG - Intergenic
1122960974 14:105093518-105093540 CCCGGGGCGCGGGCCGGGGGCGG - Intergenic
1123024896 14:105419934-105419956 GCGGGGGCGGGGGGCGCCGCAGG - Exonic
1123464648 15:20506210-20506232 CCCGAGGGGCGGGCCGACGCGGG + Intergenic
1123630801 15:22258321-22258343 CCCGGGGCGCGGCGCGGCGCGGG + Intergenic
1123653468 15:22494831-22494853 CCCGAGGGGCGGGCCGACGCGGG - Intergenic
1123743889 15:23303694-23303716 CCCGAGGGGCGGGCCGACGCGGG - Intergenic
1124275373 15:28322177-28322199 CCCGAGGGGCGGGCCGACGCGGG + Intergenic
1124307331 15:28589424-28589446 CCCGAGGGGCGGGCCGACGCGGG - Intergenic
1125051196 15:35299554-35299576 CGCGGGGCGCTGGGCGGCGCGGG + Intronic
1125606324 15:40941795-40941817 CGCGGGGGGCGGGGAGCCGCGGG - Intergenic
1125999349 15:44194865-44194887 CCCTGGGCGGCGGCCGCCGCCGG + Intronic
1127117527 15:55742979-55743001 CCCGGGGCGGGGGCCGCAGACGG - Exonic
1127753621 15:62068641-62068663 CCCGGGACGAGGGCCGCGGCCGG + Exonic
1127763444 15:62163950-62163972 CCCGGGATGAGGGTCGCGGCCGG - Exonic
1128223071 15:65982277-65982299 GCCGGCGCGGGGGTCGCAGCTGG + Exonic
1128322562 15:66703488-66703510 CCCAGGGCGCGGGGAGGCGCCGG + Exonic
1128582327 15:68818736-68818758 CGCGGGGCCGGGGTCGCCGCGGG - Intronic
1129162190 15:73753082-73753104 CCCGGGCGCCGGGTCGCCGCCGG + Intergenic
1131257471 15:90871787-90871809 CCCGGGGCCCGGCTGCCCGCCGG + Intronic
1132178470 15:99733554-99733576 CCCGGGGCGGGGCTCGGGGCGGG + Intronic
1132585889 16:705630-705652 CGCGGGGCGCAGGGCGCGGCCGG - Exonic
1132683830 16:1154092-1154114 CCCGGGGCGCGGGACTCCCTCGG + Intronic
1132729218 16:1352327-1352349 GCCGGCGCGGGGGTGGCCGCGGG + Intronic
1132856642 16:2047989-2048011 CCCTGGCCCCGGGACGCCGCCGG - Exonic
1132889185 16:2195915-2195937 CCCGGGTCGCCCCTCGCCGCAGG + Intronic
1132889331 16:2196309-2196331 CCGGGGGCGCGGGGCGCGGGTGG - Intronic
1132968541 16:2673417-2673439 CGCGGGGGGCGGGGCGTCGCGGG - Intergenic
1133118250 16:3590497-3590519 CCCAGGGCGGGAGTCCCCGCGGG - Exonic
1133188344 16:4116031-4116053 CCCGGAGCGCGGGGGGCGGCCGG - Exonic
1133241296 16:4416090-4416112 GCCGGGGCTCGGGGCGCTGCCGG - Intronic
1133801972 16:9091835-9091857 CCTGGGGCGGGGGTCGTCCCTGG + Exonic
1134070270 16:11256084-11256106 GGCGGGGCGCGGGACGCCGCGGG + Exonic
1137426328 16:48384702-48384724 CCCGGGCCTCCGGGCGCCGCGGG + Intronic
1141184792 16:81779476-81779498 CCCTGGGAGCCGGTCCCCGCGGG - Intronic
1141418923 16:83899201-83899223 GCCGGGGCCCGGGCGGCCGCGGG - Exonic
1141972241 16:87492246-87492268 CCCGGGTCGCGGCGCGGCGCGGG - Intergenic
1142206387 16:88785057-88785079 GGCGGCGCGCGGGTCCCCGCGGG - Exonic
1142414766 16:89935353-89935375 GCCGTGGCGCGGGTCGCAGGCGG - Exonic
1142631544 17:1229316-1229338 CCCGGCGGGCAGGTCCCCGCGGG + Intergenic
1143030489 17:3964529-3964551 CCCGGGGCGCGGAGGGCGGCCGG - Intergenic
1143783222 17:9240179-9240201 CGCGGGGCGGGGTGCGCCGCCGG + Exonic
1144606153 17:16667084-16667106 CACGGAGCGCGGGTAGCAGCCGG + Intergenic
1146909956 17:36642010-36642032 CGCGGGGCGGGGGGCGCTGCCGG + Intergenic
1146956051 17:36936887-36936909 CCCGGGCCGCGGCTCGTTGCTGG - Intronic
1147161846 17:38573027-38573049 CCCGGGACTCGGGTTGCAGCAGG + Intronic
1148207092 17:45785535-45785557 CCCGGGGCTCGGGACTCCGCAGG + Intronic
1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG + Intronic
1148930145 17:51120929-51120951 CCCGATGGGCGGGGCGCCGCGGG + Intergenic
1152175049 17:78782019-78782041 CGCGGGGCGGGGGTCGCAGGGGG - Intronic
1152175146 17:78782317-78782339 CGCGGGGCGCGGGGCGCCGGGGG - Intergenic
1152711283 17:81871435-81871457 CGCGGCGCGCGGGTGGCCGGGGG + Intergenic
1152748473 17:82051852-82051874 TCCGGGGCGCGGGGCGGGGCGGG - Intronic
1152758843 17:82098077-82098099 GCCGGGGCGCGGGTCGTGGTCGG - Intronic
1152923986 17:83079413-83079435 GCCGGGGCGGGGGGCGCTGCAGG - Intergenic
1155176723 18:23307636-23307658 CCCGGGGCGCTGGTCACAGCTGG + Intronic
1155877228 18:31102027-31102049 CGCGGGGCGAGGGCCGCGGCCGG + Exonic
1156171748 18:34494000-34494022 CCGGGGGCGCGGGGCCGCGCAGG + Intronic
1157867160 18:51197115-51197137 GCCGGGGCGCCGGGCTCCGCCGG + Exonic
1158401032 18:57121875-57121897 TCCTGGGCCGGGGTCGCCGCGGG - Intergenic
1158514999 18:58123512-58123534 ACCGGGGCGGGGGTCTCCTCAGG - Intronic
1158602034 18:58863825-58863847 CCAGGGGCGCGGGTGGGCGCCGG + Intronic
1160453446 18:78980162-78980184 CGCGGGGCGCGGGGCGGCGGCGG - Intergenic
1160719158 19:589985-590007 CCCGGCGCGGGGGTCGCGCCCGG - Exonic
1161264991 19:3359884-3359906 GCTGGCGCGCGGGGCGCCGCGGG + Intronic
1161425009 19:4198467-4198489 TCCGGGGCGCGGGGCGCGGGGGG - Intronic
1161620076 19:5293091-5293113 CCCGAGGCCCGGGCCGCCCCGGG - Intronic
1161820921 19:6531075-6531097 CGCGGGGCGCGGGAGGCCACGGG - Exonic
1162100470 19:8335630-8335652 CCCGGGGCGCGGCGGGCAGCGGG + Exonic
1162315496 19:9936164-9936186 CGAGGGGCGGGGGTCGCAGCGGG - Intronic
1163462753 19:17448633-17448655 TCCGGGGTGCTGGTCGCAGCCGG + Intronic
1163831759 19:19550448-19550470 CCTGGGGAGCGGGTCGGCCCTGG + Intergenic
1165089295 19:33374164-33374186 CCCGGGGCGCCCCTCGCGGCGGG + Intronic
1165242884 19:34481800-34481822 CCCGGCCCGCGCGTGGCCGCCGG + Exonic
1165242901 19:34481846-34481868 CCCTGGGCGCGGGGCGGGGCGGG - Exonic
1165402830 19:35612855-35612877 TCCGGGGCCCGGGCCGCCACGGG - Exonic
1166193739 19:41193347-41193369 CCCGGGGGGCAGGTGGCCTCGGG - Exonic
1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG + Intergenic
1168100388 19:54138231-54138253 CCCGGGGTCCGGGTCGCGGAAGG - Intronic
925610253 2:5696365-5696387 CAGGGGGCGCGGGGCGCGGCGGG + Exonic
926095767 2:10080041-10080063 CACGGGGCTGGGGTCGCGGCCGG + Exonic
926095893 2:10080372-10080394 TCCCGGGCGGGGGTCGCGGCCGG + Exonic
927472356 2:23385716-23385738 CCGGGGTCGCGGGTGGGCGCAGG - Exonic
927964788 2:27262280-27262302 CCTGGGGGGCGGGCGGCCGCCGG - Intronic
932342999 2:70978577-70978599 CCCCGGGGGCGGGGCGCCGGCGG + Intronic
933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG + Exonic
934545018 2:95207430-95207452 CCCCGGGAGCAGGTGGCCGCAGG + Intergenic
934967012 2:98731574-98731596 CCCGGAGCGGGGCGCGCCGCTGG - Intergenic
935046831 2:99490138-99490160 CCCGAGGCTGGGGTCGCCCCGGG - Intergenic
935145380 2:100391811-100391833 CCTGGGGCGCGCGTGGCCACAGG + Intergenic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
941225254 2:162839503-162839525 CCCGAGGCGCGGCTCAGCGCTGG - Intergenic
942446068 2:176079967-176079989 CCCGGGGCGCGGGAGGCCGAAGG - Exonic
943060585 2:183038296-183038318 GCCGGGGCGCGGGCTGCTGCGGG - Exonic
947117940 2:226791662-226791684 CGCGGGGCGGGGCTCTCCGCGGG - Intronic
947533728 2:230928158-230928180 CCAGGGGCACGGGCCGCCCCGGG + Intronic
947623341 2:231604628-231604650 CCAAGGGCGCGGGTGGCCGACGG + Intergenic
948116032 2:235494628-235494650 CCCGGGGCGCGGGGCGGCGGCGG + Exonic
948401822 2:237691048-237691070 CCCTGGGCCCGGGTCACGGCGGG + Intronic
948402190 2:237692231-237692253 GGCGGGGCGCAGGTGGCCGCGGG - Intronic
948492149 2:238320581-238320603 CCCGGGTCCCTGGCCGCCGCCGG - Exonic
948933661 2:241149102-241149124 CCCGCGCCTCGGGTCGCCTCGGG - Intronic
949040170 2:241844292-241844314 CCCCGGGCCTGTGTCGCCGCCGG - Intergenic
1169132441 20:3173201-3173223 CCCGGGGGGCGGGGCGCAGAGGG + Intronic
1169214712 20:3786484-3786506 CCCGGGGCGGGGGGCGCGCCGGG - Exonic
1169367164 20:5001204-5001226 CCCGGGGCCAGGGTGGCCGGCGG + Intronic
1172252578 20:33490181-33490203 CCCGGGCCGCGGGTCGAGGCGGG + Intronic
1172702927 20:36863673-36863695 GCCGGGGCCCGGGCCGCAGCCGG - Exonic
1172919960 20:38473021-38473043 GCCGGGGCGGGCGCCGCCGCCGG - Exonic
1175394735 20:58650497-58650519 CCCGGGGCACGGGGGGGCGCGGG + Intergenic
1175399520 20:58692711-58692733 CCCGGGGCGCGAGGGGGCGCCGG - Exonic
1175847201 20:62065286-62065308 CCCGGGGCCGGGGCCGGCGCGGG + Exonic
1175907234 20:62386915-62386937 CCTGGGGCGCGGGGCGTCGTGGG - Intergenic
1176037941 20:63049424-63049446 CCCTGGGCAAGGGTCGCCCCTGG + Intergenic
1176131603 20:63498875-63498897 CCCGGGGTGGGGGGCGGCGCGGG - Intronic
1176194606 20:63831385-63831407 CCCGGGGCGGTGGCCGCGGCCGG - Intergenic
1177188114 21:17819672-17819694 CCCGGGGCGGGGGCCGCAGGCGG + Intergenic
1178561459 21:33642761-33642783 GCGGGGGCGGGGGTCGGCGCGGG + Intronic
1179822650 21:43945610-43945632 CCCGTGTCTTGGGTCGCCGCTGG + Intronic
1183720188 22:39557901-39557923 CCCGGGGCGCGGGGGGCGGCGGG - Intergenic
1184033990 22:41910076-41910098 CCCGCGCCGGGGGTTGCCGCGGG + Exonic
1184523562 22:45009122-45009144 CCCGGGGCGCGGGGGCCCGAGGG + Intronic
1184663370 22:45975752-45975774 GGCGGGGCCCGGGTCCCCGCAGG + Intronic
1184753535 22:46502940-46502962 CCCCGGGAGCAGGTCCCCGCAGG + Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185133176 22:49052132-49052154 CCAGGAGCGCGTGTCCCCGCCGG + Intergenic
1185296707 22:50058298-50058320 CCCGGGGCGTGGGGCTGCGCGGG + Intergenic
1185341637 22:50293699-50293721 CCTGGGGCTAGGGGCGCCGCAGG - Intronic
1185420212 22:50730824-50730846 CTCGGGGCGCGTCTCGCCACGGG - Intergenic
950215268 3:11154438-11154460 CTCGGGGAGCGGGGCGCCGGAGG - Intronic
950710645 3:14810822-14810844 CGCGGGGCCCGGGCCGCCGTCGG - Intergenic
953485119 3:43287054-43287076 CCCAGGGCGCGGGGCCCCGCGGG - Intronic
954375817 3:50193687-50193709 CGCGGGGCGCGGGGCGCAGGGGG + Intronic
954778871 3:53045331-53045353 CCCGGGGGGCGGGTCCGCGGGGG + Intronic
954838896 3:53494524-53494546 GCCGGGGCGCGGCGCGGCGCGGG + Intergenic
960684748 3:120285231-120285253 CGCGGGGCGCCGGGCGCCTCTGG + Intergenic
961389106 3:126541944-126541966 GATGGCGCGCGGGTCGCCGCGGG - Exonic
961446241 3:126983046-126983068 CGCGCGGCGCGGGGCTCCGCGGG + Intergenic
961446302 3:126983258-126983280 CCCGGGGCGCGCCCCGCCGCCGG - Intergenic
961458190 3:127034480-127034502 CCCGGGGCCCGGTTGGCAGCTGG + Exonic
963253318 3:143120917-143120939 CCCGGCGCCCAGGACGCCGCTGG + Exonic
963904582 3:150763089-150763111 TTCGGGGCCCGGGACGCCGCCGG - Exonic
966108222 3:176362484-176362506 CCCGGGGCCCGCGCCGCCGGCGG + Intergenic
967087292 3:186107662-186107684 CCCGGGGCGCGGGTGGTGGGGGG - Intronic
967166300 3:186783148-186783170 CCCGGCTCGCGGCTCGCTGCCGG - Intergenic
968831352 4:2934322-2934344 CGCGGGGCGCGGGCCGGGGCTGG - Exonic
969362611 4:6674266-6674288 CGCGGGGCGCGGGGCTCAGCGGG - Intergenic
969858559 4:10018856-10018878 CTCGCGGCGCGGGACACCGCGGG - Intronic
974716020 4:65669704-65669726 CCCGGGGTGCGGGACGCCGGCGG - Exonic
976388094 4:84482956-84482978 CCCGGGGCGCGTGTCAGCGTTGG + Intergenic
979547126 4:121951430-121951452 TCCGAGGCGCGGGCCGCGGCCGG + Intronic
979547222 4:121951775-121951797 CCCGGGGCCCCGGAAGCCGCGGG - Intergenic
981782372 4:148443704-148443726 GCCGGGCTGCGGGTCGCCGAGGG - Intronic
984888646 4:184473248-184473270 CCCGGGGCGCGGGCCGCGGCGGG - Intronic
985129654 4:186726757-186726779 CCCGGGGCGGGGGGCGAGGCGGG - Intergenic
986008146 5:3684999-3685021 CCCGGGGCGGGGCTCGGCCCAGG + Intergenic
987099954 5:14582341-14582363 CCCGGGGCGCGTGGACCCGCGGG + Intronic
988482041 5:31639195-31639217 CCCGGGCAGCGGGACGCGGCGGG + Intergenic
988577926 5:32444551-32444573 CCCGGGCAGCGGGGAGCCGCGGG - Intronic
989963307 5:50440975-50440997 CGCGAGGCTCGGGTCCCCGCGGG - Intronic
990383017 5:55233844-55233866 ACCGGAGCCCGGGTCGCTGCGGG + Intergenic
992962835 5:81972441-81972463 CCGGGGAAGCGGGTCCCCGCCGG + Intronic
993901600 5:93587798-93587820 CGCGGGGCGCGTGTGGCTGCGGG + Intronic
998140467 5:139697106-139697128 GCTGGGGCGGGGGTGGCCGCGGG - Intergenic
999300107 5:150485870-150485892 CCCGGGGCGGGGGCCGGGGCGGG - Intronic
1000232830 5:159331583-159331605 TCCGGGGCGCGGGTGGACTCCGG - Intergenic
1001563225 5:172683639-172683661 CCCGCGGCCCGCGTCGTCGCCGG + Exonic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1002662789 5:180802899-180802921 GCCGGGGGGCGGGGCGCGGCGGG - Intronic
1003097479 6:3154277-3154299 GCCGTGGCGCGGGTCGCAGGCGG + Exonic
1003107019 6:3225165-3225187 GCCGTGGCGCGGGTCGCAGGCGG + Exonic
1003139145 6:3456731-3456753 CCCGGGGCGCGGGGTCCGGCGGG - Intronic
1003624257 6:7727709-7727731 CCCGGCGCGCGGGTCCCGCCTGG + Intronic
1004241327 6:13924997-13925019 CCCGGGCCCTGGGCCGCCGCCGG + Exonic
1007397676 6:41586916-41586938 CCCTGGGAGGGGGTGGCCGCGGG + Intronic
1008092797 6:47309538-47309560 CCCGGGGCGCGCGGGGCAGCTGG + Exonic
1016657931 6:146543351-146543373 CCCGGGGCCGGGGTCGGCGTGGG - Intergenic
1018757545 6:166862943-166862965 CTCGGGGCGGGGGCAGCCGCGGG - Intronic
1019457538 7:1138253-1138275 CCTGGGGCGCGGGTCCCTGCCGG - Intronic
1019711519 7:2520157-2520179 CAGGGGGCGCGGGTGGCCGTCGG - Exonic
1020130237 7:5555383-5555405 CCCGGCGTGGGGGTCGCGGCAGG - Intronic
1020201168 7:6081345-6081367 ACCGGGGGCCGGGCCGCCGCGGG + Intergenic
1020224962 7:6272613-6272635 CGCGCGGCCCGGGTCGCGGCCGG + Exonic
1023064817 7:36366954-36366976 CCCGGGGCGGCGGGCTCCGCGGG + Intronic
1023294309 7:38699192-38699214 CCCGGGGCATGGGTGGCAGCCGG + Intergenic
1024579934 7:50793284-50793306 CGGCGGGCGCGGGTCCCCGCGGG + Intronic
1024766795 7:52669239-52669261 CCCAGGGCGCGGCTCGCCGTTGG - Intergenic
1025007564 7:55366128-55366150 GCCGGGGCGCTGCTCGCCTCCGG + Exonic
1025698082 7:63790269-63790291 ACCTGGGCTCGGGTCGCCCCCGG - Intergenic
1025739089 7:64182167-64182189 CCAGCGGCGCGGGCCGCAGCCGG + Intronic
1026025550 7:66741114-66741136 GCCGGGGCGAGGGGAGCCGCCGG - Intronic
1027260557 7:76461882-76461904 CCAGGGGCGCGGGGTGGCGCGGG + Intronic
1027311936 7:76959995-76960017 CCAGGGGCGCGGGGGGGCGCGGG + Intergenic
1029413676 7:100430327-100430349 CCGGGGGAGCGGCTCGCCCCGGG - Exonic
1029896614 7:103990101-103990123 CGAGGGGCGCGGGACGCAGCCGG - Intergenic
1031401625 7:121330420-121330442 CCCGCGGCGCGGGAAGCTGCAGG + Intronic
1032119326 7:129144993-129145015 CCCCGGGCGCCGGCCGCCTCCGG + Exonic
1033333760 7:140435470-140435492 CCCGGGGCGCGGGACCACACTGG + Intergenic
1034223076 7:149460415-149460437 GCCGGGGCCCAGCTCGCCGCCGG - Intronic
1034339184 7:150341196-150341218 CCCGGCGCGGGGGCTGCCGCGGG + Exonic
1035127162 7:156616825-156616847 CGCGGGGCGCGGGAGGCGGCAGG - Intergenic
1035717175 8:1763595-1763617 CGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035747712 8:1973992-1974014 CCCGAGGCGCGGGTCGGAGGGGG + Intronic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1038039776 8:23714855-23714877 CCCGGGTCGCGGTTCCCTGCGGG + Intergenic
1040981619 8:53251180-53251202 CCCGGGCCGCAAGTCGCCGGGGG + Intronic
1041968185 8:63705087-63705109 TCCGGGGCGCGGGTGGGGGCGGG + Intergenic
1042271590 8:66961676-66961698 CCCGGGACGCGAGTCGCGGATGG + Exonic
1044832250 8:96261835-96261857 CCTGGGGCAGGGGACGCCGCCGG - Exonic
1045277439 8:100721201-100721223 CCGGCAGCGCGGGTCCCCGCCGG + Intronic
1049406177 8:142452749-142452771 CCGGGGGCGGAGGACGCCGCAGG - Intronic
1051170606 9:14315458-14315480 CCCGGGGCCCGGGGCGCCGGCGG + Intronic
1054781953 9:69174050-69174072 CGCGTGACGCGGTTCGCCGCAGG + Intronic
1056243001 9:84668390-84668412 CCCATGGCCCGGGTCGCGGCGGG - Intergenic
1056732477 9:89178102-89178124 GCCGGGGCGCGGGGCGCCGAGGG + Exonic
1059061298 9:111037892-111037914 CCAGGGGCTCGGTCCGCCGCTGG + Exonic
1059414735 9:114155810-114155832 CCCTGGGCGCGGGGCTGCGCTGG + Exonic
1060916948 9:127397478-127397500 CCGGGGGCGCGGCGCGCTGCAGG - Exonic
1061190793 9:129081451-129081473 CCCGGGTCCCGGGGCGCCGGTGG + Intronic
1061241735 9:129378497-129378519 CCAGGGGTGGGGGTGGCCGCGGG + Intergenic
1061851341 9:133417868-133417890 CCGGGGTCTCGGGTGGCCGCCGG - Exonic
1061975963 9:134068159-134068181 CCCGGGGCGGGGCGCGGCGCCGG - Intronic
1062022760 9:134326938-134326960 GCCGGGGCGCAGGCGGCCGCCGG - Intronic
1062305845 9:135906947-135906969 CCAGGGGCGCGGGCCGGGGCCGG - Intronic
1062344649 9:136109232-136109254 CCCTGGGCCCGGGTCACCGCTGG + Intergenic
1185508228 X:644318-644340 CCGGGGGCGCGGGGCGGAGCAGG + Intronic
1187900908 X:24025754-24025776 GCCGGGACGCGGGGCGCCGCGGG - Intronic
1189446495 X:41085650-41085672 CCCGGTGCTTGGGTCGGCGCCGG + Exonic