ID: 1083901773

View in Genome Browser
Species Human (GRCh38)
Location 11:65646799-65646821
Sequence CCCGGGGCGCGGGTCGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083901761_1083901773 24 Left 1083901761 11:65646752-65646774 CCGAGCTGCAGGCAGCGGGCTCA 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083901773 Original CRISPR CCCGGGGCGCGGGTCGCCGC CGG Exonic