ID: 1083901773 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:65646799-65646821 |
Sequence | CCCGGGGCGCGGGTCGCCGC CGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 317 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 30, 4: 283} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1083901761_1083901773 | 24 | Left | 1083901761 | 11:65646752-65646774 | CCGAGCTGCAGGCAGCGGGCTCA | 0: 1 1: 0 2: 1 3: 21 4: 221 |
||
Right | 1083901773 | 11:65646799-65646821 | CCCGGGGCGCGGGTCGCCGCCGG | 0: 1 1: 0 2: 3 3: 30 4: 283 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1083901773 | Original CRISPR | CCCGGGGCGCGGGTCGCCGC CGG | Exonic | ||