ID: 1083902658

View in Genome Browser
Species Human (GRCh38)
Location 11:65651099-65651121
Sequence ATTTGGTTCTGCAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083902651_1083902658 12 Left 1083902651 11:65651064-65651086 CCAGGCCACTGCTTGGCTTCTCT 0: 1
1: 0
2: 1
3: 45
4: 431
Right 1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237
1083902652_1083902658 7 Left 1083902652 11:65651069-65651091 CCACTGCTTGGCTTCTCTCCCAT 0: 1
1: 0
2: 6
3: 60
4: 497
Right 1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237
1083902649_1083902658 19 Left 1083902649 11:65651057-65651079 CCTGAGGCCAGGCCACTGCTTGG 0: 1
1: 0
2: 2
3: 32
4: 341
Right 1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237
1083902648_1083902658 20 Left 1083902648 11:65651056-65651078 CCCTGAGGCCAGGCCACTGCTTG 0: 1
1: 0
2: 2
3: 32
4: 275
Right 1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083902658 Original CRISPR ATTTGGTTCTGCAGGGAAGC AGG Intergenic
900153949 1:1196585-1196607 ATCCGCTTCTGCAGGGAGGCAGG - Exonic
900161494 1:1226241-1226263 ATCTCGTGGTGCAGGGAAGCGGG + Intronic
900187139 1:1337816-1337838 ATTGGGGTCAGCAGAGAAGCAGG + Intronic
900561563 1:3309679-3309701 AGCTGGTCCTGCAGGGATGCGGG - Intronic
901754909 1:11435535-11435557 AAATGGTGCAGCAGGGAAGCTGG - Intergenic
902434921 1:16392301-16392323 GTTTGGTTCTGAAGAGAAGCTGG + Intronic
902583423 1:17423548-17423570 ATTTGGTTCTGCAGAGGACTTGG - Intronic
910291057 1:85600795-85600817 ATTAAGTTATCCAGGGAAGCTGG - Intergenic
911942287 1:104061909-104061931 ATTTGGTTCGGCAGAGTAGATGG + Intergenic
911975091 1:104482699-104482721 ATTTGGTTCTGTATGGAGGATGG - Intergenic
912529948 1:110313010-110313032 AGCTGGTTATGCAGGGACGCAGG - Intergenic
912950397 1:114116712-114116734 ATGTGGTCTTGCTGGGAAGCTGG - Intronic
915834673 1:159166745-159166767 GTTTGGTTCTGAAGGAAAGATGG - Intergenic
921163439 1:212488899-212488921 ATCTGGCTCTGCTGGGATGCTGG + Intergenic
924538263 1:244956973-244956995 AGTTGGTGCTGCAGGGAATAAGG + Intergenic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
1067190004 10:44061085-44061107 ATTTGCTTCTGCAGGCAATGGGG + Intergenic
1067682487 10:48449780-48449802 GCTTGGTTCAGCAGGGAAACTGG + Intronic
1068866696 10:61902500-61902522 ATTCACTTCTGCAGGCAAGCAGG + Intronic
1069020598 10:63483740-63483762 TTTGGGTTCTGCAGAGAATCAGG - Intergenic
1071988370 10:91075304-91075326 ATGTGGTCCTGCAGGGACACAGG - Intergenic
1075408650 10:122211381-122211403 ATTGGGTTCAGCAGGGGATCTGG - Exonic
1075551067 10:123392574-123392596 ATTTGGTTAAGCTGGGAGGCAGG + Intergenic
1075571967 10:123552712-123552734 ACCTGGTTCAGCAGAGAAGCTGG - Intergenic
1076748644 10:132528327-132528349 ATTTGGTGGAGCAGGGAGGCAGG + Intergenic
1077172564 11:1174481-1174503 ATGCAGTTCTGCAGGGAAGGGGG - Intronic
1077299501 11:1840474-1840496 AGGTGGGTCTGCAGGGGAGCTGG + Intronic
1077652487 11:3985769-3985791 AGTTAGGTCTGAAGGGAAGCAGG - Intronic
1078156230 11:8802369-8802391 ATTTTGTTCAGCAAGGAGGCAGG + Intronic
1079438659 11:20485218-20485240 TTTTGTTTCTGCAAGGAACCTGG - Intronic
1079524012 11:21362938-21362960 ATATGGTTCATCAGGGAAGTGGG + Intronic
1082124709 11:48418498-48418520 GTTTGTGTCTGCAGGGAAGTAGG + Intergenic
1083892833 11:65605394-65605416 ATTTGGTACCCAAGGGAAGCTGG - Intronic
1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG + Intergenic
1084776430 11:71379979-71380001 TTCTGGTTCTACTGGGAAGCAGG + Intergenic
1086806133 11:91245086-91245108 ATTTGGTCCTCTGGGGAAGCAGG - Intergenic
1089255705 11:117192805-117192827 ATGCGGTCCTGGAGGGAAGCAGG - Exonic
1091187940 11:133663311-133663333 ATGTGGGTCTGCAGAGAGGCTGG - Intergenic
1091262683 11:134246437-134246459 GATTGGTTCTTCAGGGAACCAGG - Exonic
1091658861 12:2366459-2366481 ATTGGGTGCTGGAGGGAAGCAGG + Intronic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1093233173 12:16574028-16574050 ATTTGTTACTTCGGGGAAGCGGG - Intronic
1094425150 12:30309609-30309631 ATTTGGCTCAGCAAGGAAGTAGG - Intergenic
1097739464 12:63222595-63222617 TTTTGGTTCCGCTGGGAATCTGG - Intergenic
1098192959 12:67969725-67969747 ATTTGTTTCAGCAGGACAGCTGG + Intergenic
1099781483 12:87201236-87201258 ATTTGGCTCTGTAAGGATGCAGG + Intergenic
1100805800 12:98282333-98282355 AATGTGTTCTGCAGGGAAGGAGG - Intergenic
1102775461 12:115515055-115515077 AGTTGGTTCTGCAGTGAATATGG - Intergenic
1103444783 12:120987521-120987543 TTCTGGTGCTGCAGGGAAACAGG + Intronic
1103492942 12:121337331-121337353 AATTCCTTCTGCAAGGAAGCTGG + Exonic
1104749518 12:131229550-131229572 AGGTGGGTCTGCAGGGAGGCCGG - Intergenic
1105419387 13:20239317-20239339 ATGCTGTTCTGCAGGGAATCAGG + Intergenic
1107022702 13:35767747-35767769 ATTTGGAAGTGCAGGCAAGCTGG + Intergenic
1109632226 13:65065262-65065284 ATTGGGTGCTGTTGGGAAGCAGG - Intergenic
1111094761 13:83498401-83498423 AATTGGATCTGCAGAGAAGTGGG + Intergenic
1111997320 13:95177561-95177583 AAATGGATCTTCAGGGAAGCAGG + Intronic
1111998144 13:95184991-95185013 AAATGGATCTTCAGGGAAGCAGG + Intronic
1112630721 13:101158643-101158665 AGTTGGTTGTGAAAGGAAGCTGG - Intronic
1113876168 13:113596215-113596237 ATTATATTTTGCAGGGAAGCAGG + Intronic
1115196195 14:30802495-30802517 ATTTGGTTCTGAAATAAAGCTGG + Intergenic
1115959583 14:38820260-38820282 ATTTGATTCAGCAGTGATGCAGG - Intergenic
1118173237 14:63410544-63410566 GTTTGGTTCTGCTGGGGAGTGGG - Intronic
1120673261 14:87388608-87388630 AGGTGGTTCTGATGGGAAGCTGG - Intergenic
1120933179 14:89868873-89868895 ATTTGTTTCTGTAAGAAAGCAGG - Intronic
1122179036 14:99942258-99942280 CTTACGTGCTGCAGGGAAGCTGG - Intergenic
1122721605 14:103725460-103725482 ATTTGGGGCTGCTGAGAAGCTGG + Intronic
1202833287 14_GL000009v2_random:59072-59094 ATTTGGGGCTGCAGAGCAGCTGG - Intergenic
1126366369 15:47898823-47898845 ACTTGGTGCTGCAGGGAGGAGGG - Intergenic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1130438443 15:83926093-83926115 AATTGGTGGGGCAGGGAAGCCGG + Intronic
1132041024 15:98524729-98524751 ATTTGGATTTGCAGGGAGGGGGG + Intergenic
1133030724 16:3009818-3009840 ATTGGGTCCTCCAGGGAAACCGG - Intergenic
1136610178 16:31361450-31361472 TTTTTGTTCTGCAGTGGAGCCGG - Intronic
1137944056 16:52717074-52717096 ATTGGTTTCTGCAGGGCTGCAGG - Intergenic
1138098103 16:54229439-54229461 ATTTGCTTCTGGAGGACAGCAGG - Intergenic
1140216158 16:73010566-73010588 ACCTGGTTCTGCAGGTCAGCAGG - Intronic
1140733082 16:77873970-77873992 CTCTGGTTCTGCAGAGAAGCAGG - Intronic
1140897368 16:79336448-79336470 ATTAGCTTCTTCAGGGATGCTGG + Intergenic
1143090955 17:4448916-4448938 ATTTGGTCCTGCAGAGAGGAGGG + Intronic
1143930244 17:10415137-10415159 CTTTGGTACTACAGGGAAGCTGG - Exonic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1145879886 17:28345249-28345271 GATTGATTCTGCAGGGAAGTGGG - Exonic
1145915566 17:28571760-28571782 AGTGTGTTCTACAGGGAAGCGGG - Exonic
1147537257 17:41328772-41328794 ATCTGGGGCTGCGGGGAAGCTGG - Intergenic
1148096908 17:45058755-45058777 ATTTGCAGCTGCAGGGAAGGGGG - Intronic
1151149709 17:72074565-72074587 GTTTGGTTCTCCAAGGCAGCAGG + Intergenic
1151944023 17:77309559-77309581 ATGTGGATCTACAGAGAAGCTGG - Intronic
1153691103 18:7594594-7594616 ATTTCCTTCTGCAGGACAGCAGG - Intronic
1154428408 18:14289846-14289868 AGTTGGATCTGCAGGGATGCAGG - Intergenic
1155493237 18:26419918-26419940 ATTTCATTCTGCAGGGAACAGGG - Intergenic
1163588284 19:18175751-18175773 ATTTGGGTCTGCCTGGATGCAGG - Intronic
1166195734 19:41204514-41204536 GTTTGATTCTGCAGTGAAGGTGG - Intronic
1202639382 1_KI270706v1_random:68624-68646 ATTTGGGGCTGCAGAGCAGCTGG + Intergenic
925197308 2:1936760-1936782 ATGGTGTCCTGCAGGGAAGCTGG + Intronic
925258971 2:2513038-2513060 ATTTGCTGCTTCAAGGAAGCTGG + Intergenic
926118779 2:10229688-10229710 AGTGGGTGCTGCAGGGAAGAGGG - Intergenic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
926664168 2:15501711-15501733 ATATGGTTATACAGGAAAGCAGG + Intronic
928143458 2:28751248-28751270 AATTAGTTCTGCAGGGATTCTGG - Intergenic
928659543 2:33487446-33487468 ATTTGGGTGTGCAGGAAAGGAGG + Intronic
929395609 2:41518766-41518788 ATGTGGTTCTCCTGGGAAGGAGG + Intergenic
929930551 2:46252408-46252430 ATTTGGGCCTGGGGGGAAGCAGG + Intergenic
930511287 2:52348702-52348724 ATTTTATTCTTAAGGGAAGCAGG - Intergenic
934494847 2:94788086-94788108 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
937104108 2:119294382-119294404 ATTTGGCTGTGAAGGGAAGATGG + Intergenic
937820492 2:126304653-126304675 ATTTGGTTCCTCATGGAAGTGGG + Intergenic
943712784 2:191116272-191116294 ATATGATTCTGCAGAGAAGGTGG - Intronic
944153985 2:196592625-196592647 GTTTGGTTCTCCAGGGAAACTGG - Intronic
944415649 2:199477150-199477172 ATTTGGTCTTGCAGGTAAGTGGG - Intergenic
945824659 2:214706631-214706653 TATTGGTTCTGCAGGGCAGATGG - Intergenic
946204666 2:218095329-218095351 TTTTGGTGATGCAGGGAAGAAGG - Intergenic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
947660518 2:231863102-231863124 AGTTGCTTTTGCAGGGAGGCAGG - Intergenic
948372382 2:237497637-237497659 AATTGGTTCTGCAGAGGAGCTGG + Intronic
948764490 2:240212470-240212492 CCTTGGTCCTGCAGGGAGGCTGG + Intergenic
1168978438 20:1985336-1985358 ATTTATTCCTTCAGGGAAGCGGG + Intronic
1169895536 20:10501610-10501632 ACTTGGTTCTCGAGGGCAGCAGG + Intronic
1170285846 20:14707471-14707493 ATTTTGTTCTAGAGGGAGGCAGG - Intronic
1170996212 20:21362109-21362131 ATGTGGTTCTGAGGGGAAGTAGG + Intronic
1171088889 20:22265768-22265790 GTCTGGCACTGCAGGGAAGCTGG + Intergenic
1172188153 20:33044327-33044349 CTTGGGATCTGGAGGGAAGCTGG + Intergenic
1174378254 20:50140324-50140346 ATCTGATGCTGCAGGGAAGATGG - Intronic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1175138393 20:56842074-56842096 AGCTGTTTCTGCAGAGAAGCTGG + Intergenic
1176647712 21:9366233-9366255 ATTTGGGGCTGCAGAGCAGCTGG + Intergenic
1176849096 21:13899118-13899140 AGCTGGATCTGCAGGGATGCAGG + Intergenic
1179557413 21:42188836-42188858 ACTTGCATCTGCTGGGAAGCAGG + Intergenic
1179568179 21:42262062-42262084 ATTATGTTCTGCAGGTAACCAGG + Intronic
1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG + Exonic
1179826442 21:43968721-43968743 AAGTGGTTCTGCAGGGACGCAGG - Intronic
1180091791 21:45537291-45537313 ATATGGTCCTGGAGGGAACCCGG - Intronic
1180362561 22:11913240-11913262 ATTTGGGGCTGCAGAGCAGCTGG - Intergenic
1181730554 22:24843313-24843335 ATGTGTTTCTGCAGAGAAGGTGG + Intronic
1181881080 22:25980484-25980506 AGTTGGCTCTGCAGCCAAGCAGG - Intronic
1182431646 22:30302374-30302396 TTCTGGTCCTGCAGGGAGGCAGG - Intronic
1183265057 22:36819686-36819708 TTTGGGTGCTGGAGGGAAGCAGG - Intergenic
1183539698 22:38422958-38422980 CCCTGGCTCTGCAGGGAAGCTGG + Intergenic
1183628424 22:39018657-39018679 ATTTGGTTATGCTGGGGAGATGG - Exonic
1183631027 22:39032566-39032588 ATTTGGTTATGCTGGGGAGATGG - Exonic
1183834896 22:40444097-40444119 ATCTGGTTCAGTAGGGAAGGTGG - Intronic
1183966570 22:41446206-41446228 AGTGGGGTCTGGAGGGAAGCTGG + Intronic
950822629 3:15777369-15777391 ATTTGGTTCTACACGGAATCAGG + Intronic
951231545 3:20185778-20185800 ATTAGGGTCTCCATGGAAGCCGG + Intronic
951954902 3:28242970-28242992 ATTTGGTTCTTGAGGGTAGAAGG + Intronic
952404864 3:32996888-32996910 CTTTGGCACTGCAGGGATGCAGG + Exonic
952858600 3:37793783-37793805 AGTTGGTCCTGCCTGGAAGCAGG + Intronic
953211918 3:40883853-40883875 ATGGGGTTGTGCAGGGCAGCAGG + Intergenic
954211710 3:49101412-49101434 ATTGGGTTCTGGCGGGAACCGGG + Exonic
956471662 3:69573531-69573553 ATTTGGATCTGCAGGGGAAATGG + Intergenic
958688782 3:97433789-97433811 GTTTGGTACTGCAGGGGATCTGG - Intronic
959366730 3:105469673-105469695 ATTTGTATCTGTAGGGAAGTTGG + Intronic
960425732 3:117505814-117505836 ATTTGGTGCTGCATGGAGGGTGG - Intergenic
961713665 3:128845115-128845137 CTTTGGTTTTGCTGGGAAGGTGG + Intergenic
966866315 3:184260826-184260848 ATTTGGGGCTGCACGGAAGTGGG - Intronic
967324259 3:188223587-188223609 ATTTGTGCCTGGAGGGAAGCTGG + Intronic
967962112 3:194933755-194933777 TTCTGGTTCTGCAGGAAAACAGG - Intergenic
1202739169 3_GL000221v1_random:38754-38776 ATTTGGGGCTGCAGAGCAGCTGG - Intergenic
968391817 4:199049-199071 ATTTTGTTCTGCAGTTAAGCAGG - Intergenic
968939523 4:3630795-3630817 ATAGGGTTCTGGAGGGCAGCAGG + Intergenic
969082203 4:4627428-4627450 GTTTCCTTTTGCAGGGAAGCAGG - Intergenic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
971158409 4:24107719-24107741 AGTTGGTTCTGCAGGCAATAGGG + Intergenic
973277848 4:48328138-48328160 ATTTGGTGCTGTAGGGAATTGGG - Intergenic
974316570 4:60289794-60289816 ATTTGCTTCTGCAGTTTAGCAGG + Intergenic
975477073 4:74835459-74835481 ATTTGGTTATGCAGGGGTGATGG - Intergenic
976009029 4:80465167-80465189 ACTTGCATCTGCTGGGAAGCAGG - Intronic
976743775 4:88383321-88383343 AGCTGGTTCTGAAGGGCAGCTGG + Exonic
977080285 4:92518394-92518416 ATTTGGTTGAGCACTGAAGCTGG + Intronic
977139577 4:93351287-93351309 ATTTGGCTCTGCATGCAAACAGG + Intronic
978445917 4:108779780-108779802 AGCTGGCTCTGCAGGGAAGGAGG + Intergenic
978565204 4:110073943-110073965 ATTTTGTTTTGCAGAGAAGGAGG - Intronic
979210869 4:118100393-118100415 ATGTGGTTGTGGAGGCAAGCTGG - Intronic
979217414 4:118182165-118182187 AGTTGGTTCATCATGGAAGCAGG + Intronic
980132343 4:128828512-128828534 ATTTGCTTCTCCAGGGAACTTGG - Intronic
981080458 4:140634734-140634756 ATTTTGGTGAGCAGGGAAGCAGG - Intronic
981327523 4:143467692-143467714 ATTTGCTTCTGCTAGGAACCAGG + Intronic
983990126 4:174108181-174108203 TTTGGGTTTTGCAGGGAGGCTGG + Intergenic
985354927 4:189108611-189108633 AGTGGGTTCTGCAGGGATGACGG - Intergenic
1202766741 4_GL000008v2_random:154493-154515 ATTTGGGGCTGCAGAGCAGCTGG + Intergenic
990749556 5:58999923-58999945 ATAAGGAACTGCAGGGAAGCCGG + Intronic
990949127 5:61278896-61278918 ATTAGGTTCTTCAGGGAACGAGG - Intergenic
992729509 5:79647073-79647095 ATATGGTTCTGTTGGGAAGCAGG - Intronic
992784085 5:80153835-80153857 TAGTGGTTCTGCAGGGAAACAGG - Intronic
994750348 5:103729752-103729774 ATGTAGTTCTTCAAGGAAGCAGG - Intergenic
995652798 5:114389773-114389795 ATTTGCTTCTGCTGGAAAGCAGG + Intronic
996579041 5:125009518-125009540 ATTTGGTTGTGAATGGAAGATGG + Intergenic
997910378 5:137866118-137866140 ATTTGGTTCTGCTGGAGAACAGG - Intergenic
998471192 5:142385244-142385266 ATTTTGTTCTGCAGTGCTGCTGG + Intergenic
999747348 5:154602629-154602651 TTAGGGTTCTGCAGGGAAACAGG - Intergenic
1000462227 5:161536930-161536952 GTTTGGTTCTGAAGGGATGTAGG - Intronic
1003716963 6:8658343-8658365 TTCTGTTTCTGCAGGGATGCCGG + Intergenic
1007827323 6:44610328-44610350 AATGGCTTCTGCAGGGGAGCAGG - Intergenic
1011823570 6:91280585-91280607 ATGTGGTTCTTCAGGGAGGCTGG + Intergenic
1013288262 6:108698783-108698805 ATTTGATGCTGCAGGTAAGAGGG + Intergenic
1013605667 6:111745306-111745328 ATGTGTTTCTTCAGGCAAGCAGG - Intronic
1015142491 6:129950826-129950848 ATTTGGTTTTGCAGCCAAGAAGG + Intergenic
1016023466 6:139259866-139259888 ATTTAGTTCTCCATAGAAGCTGG + Intronic
1018049399 6:159996265-159996287 ATTGGGTTGTGCAGGCCAGCAGG + Intronic
1018439141 6:163793052-163793074 GTTTTGTTCTACAGGGAAGGAGG - Intergenic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1020263894 7:6547644-6547666 CTTTGGTGATGTAGGGAAGCTGG + Intronic
1020509001 7:9028895-9028917 ACTTAGTTCTGCAGGGAGGATGG + Intergenic
1021876775 7:25057075-25057097 AAGTGCTTCTGCAGGGAAGTTGG + Intergenic
1021989863 7:26130777-26130799 GGTGGGTTCTGTAGGGAAGCAGG - Intergenic
1022311007 7:29195375-29195397 ATTTGGGTGTCCAGGGTAGCGGG - Intronic
1022388116 7:29920698-29920720 GGGTGGTTCAGCAGGGAAGCCGG - Intronic
1023538456 7:41238931-41238953 ATGTGGCTGTGCAGGGAAACAGG - Intergenic
1024468708 7:49742912-49742934 CTTTTGTTCTGCAGAGAAGGTGG - Intergenic
1028197109 7:87920149-87920171 ATATGGTTCACCAGGGAAGTAGG - Intergenic
1028776264 7:94680619-94680641 ATTTGGTGCTGAAGGGATGATGG + Intergenic
1031009395 7:116509770-116509792 CTTGGGTTCTGCAGGGATGACGG + Intergenic
1031907912 7:127481077-127481099 ATTTGTTTCTGCCAGGAACCCGG - Intergenic
1032448463 7:132004705-132004727 ATTTGCTTCTACAGGGAGACAGG + Intergenic
1034517373 7:151591328-151591350 ATTATGGTCTGCAGAGAAGCTGG + Intronic
1036503783 8:9336913-9336935 ATTTGGATCTGCATTGAAGAGGG - Intergenic
1036980529 8:13465216-13465238 ATTTTGTTCTCCAGGAAAGGTGG - Intronic
1037668995 8:20998121-20998143 ATTTGGTTCTGGTTGGAAACAGG - Intergenic
1039385774 8:37134347-37134369 ATTTGGTTCTGGTGGGAGGGTGG - Intergenic
1039473926 8:37829473-37829495 ATATGTTTCTGCAGGGAACAGGG - Exonic
1040548742 8:48422381-48422403 CGTGCGTTCTGCAGGGAAGCTGG + Intergenic
1042627393 8:70773269-70773291 ATATGGATATGCAGGGAAGCAGG + Intronic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1043627513 8:82280637-82280659 ATTTGCTTCTGCAAGGCACCTGG - Intergenic
1044722814 8:95167445-95167467 ATGCGGCTCTGCAGGGAAGGGGG - Intergenic
1049651023 8:143769837-143769859 ATTTGGTTCTGCAGCACAGATGG - Intergenic
1050139886 9:2506532-2506554 TTTTTCTCCTGCAGGGAAGCTGG - Intergenic
1051739395 9:20236903-20236925 GTTTGGTCCTGCAGGAAATCAGG + Intergenic
1052004250 9:23327294-23327316 TTTTGGTTCTGCAGAGTAGATGG - Intergenic
1052877077 9:33575368-33575390 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1053365656 9:37520835-37520857 ATTTGGTACTGCAGGGACAGGGG + Intronic
1053498928 9:38569026-38569048 ATCTGGGGCTGCAGGGCAGCTGG + Intronic
1053662269 9:40292273-40292295 ATCTGGGGCTGCAGGGCAGCTGG - Intronic
1053912720 9:42922440-42922462 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1054522341 9:66084011-66084033 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1055071372 9:72169807-72169829 ATTTGGTTTTCCAGGGGAACTGG + Intronic
1055528255 9:77156797-77156819 TTTTGGTCCTGAAAGGAAGCTGG + Intergenic
1056422691 9:86445066-86445088 ATTTGGTTGGGGAGGGGAGCGGG - Intergenic
1056628819 9:88275932-88275954 ATTTGGCTGTCCAGGGAGGCAGG - Intergenic
1057678375 9:97153518-97153540 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1203707900 Un_KI270742v1:69198-69220 ATTTGGGGCTGCAGAGCAGCTGG - Intergenic
1203547494 Un_KI270743v1:139372-139394 ATTTGGGGCTGCAGAGCAGCTGG + Intergenic
1185670744 X:1807465-1807487 AATTGGCTTTGCAGGGCAGCTGG - Intergenic
1185678150 X:1865568-1865590 ATGTGGTTCTGCAGAAATGCAGG - Intergenic
1185827741 X:3268681-3268703 ATGGGCTGCTGCAGGGAAGCAGG - Intergenic
1186122685 X:6380967-6380989 ATTTGCCTCTGCAGAGAAGTAGG - Intergenic
1187291496 X:17958679-17958701 ATTTGCTTCAGCAGGGAATCAGG + Intergenic
1188224452 X:27579769-27579791 ATTTGCTTCTGCATTTAAGCTGG - Intergenic
1188981761 X:36733273-36733295 GTTAGGTTATGCATGGAAGCAGG - Intergenic
1189686641 X:43571130-43571152 ATTTGGTTCTGTAAAGAAACAGG - Intergenic
1189720696 X:43913315-43913337 ATTTGATTCTGCAGGCAAGTTGG + Intergenic
1190148517 X:47920617-47920639 ATTTTGTTCTGTAGGGGAGTAGG + Exonic
1190594199 X:52036764-52036786 ATTTTGCTGTGAAGGGAAGCAGG + Intergenic
1192158629 X:68766325-68766347 ATTTGCATCTGCAGTGAAGTAGG + Intergenic
1192591536 X:72363986-72364008 CCTTGGTTCAACAGGGAAGCAGG + Intronic
1198685109 X:139220575-139220597 ATTTGGGTGTGCAGAGAAGTGGG + Intronic
1200156916 X:153981737-153981759 ATTTGCTTCTCCAGTGAAGATGG + Intronic