ID: 1083903322

View in Genome Browser
Species Human (GRCh38)
Location 11:65654475-65654497
Sequence GCCCCCAGTGGAGCAGGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 2, 1: 0, 2: 3, 3: 45, 4: 482}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083903312_1083903322 7 Left 1083903312 11:65654445-65654467 CCTGAAAGGAGGCCATTGGGGAG 0: 1
1: 0
2: 1
3: 10
4: 207
Right 1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG 0: 2
1: 0
2: 3
3: 45
4: 482
1083903316_1083903322 -5 Left 1083903316 11:65654457-65654479 CCATTGGGGAGCCCCGGGGCCCC 0: 1
1: 0
2: 3
3: 36
4: 231
Right 1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG 0: 2
1: 0
2: 3
3: 45
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083903322 Original CRISPR GCCCCCAGTGGAGCAGGAGC TGG Exonic
900109775 1:1000505-1000527 TCCCCCAGTGGCGCAGGGTCCGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900240823 1:1616402-1616424 GGCCCGAGTGGACCTGGAGCCGG + Intronic
900307771 1:2019450-2019472 GCGCGCAGAGGAGCAGGAGCGGG - Exonic
900366483 1:2313896-2313918 GCCCACCCTGGGGCAGGAGCTGG + Intergenic
900537948 1:3188019-3188041 GGCCCCAGTGAAGCAGGACAGGG + Intronic
900582711 1:3416919-3416941 GACCTCAGTGGAGAAGGAGATGG - Intronic
900598896 1:3494680-3494702 GCCCCCATTTCTGCAGGAGCAGG + Exonic
901641094 1:10693618-10693640 GAACCGAGAGGAGCAGGAGCTGG - Intronic
902089603 1:13892954-13892976 GTCCCGAGTGGAGGATGAGCCGG + Intergenic
902304403 1:15525241-15525263 GCCCGCGGTGGACCAGGAACTGG - Intronic
903331939 1:22600963-22600985 GCCAACAGTCGAGCATGAGCTGG - Exonic
903380401 1:22892798-22892820 GCCCCCAATGTGGCAGGAGCAGG + Intronic
904117625 1:28174249-28174271 GGCAACAGTGGAGCAGGAGCCGG - Intronic
904572449 1:31477180-31477202 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
905010338 1:34742738-34742760 GCCCCTACAGGAGCAGGAGCTGG + Intronic
905262929 1:36731916-36731938 GCCACAAGTAGACCAGGAGCAGG - Intergenic
905932843 1:41801773-41801795 GCCCCTAGGGGTCCAGGAGCAGG + Intronic
905939126 1:41848897-41848919 GCCCCAAGAAGAGCTGGAGCTGG - Intronic
906041734 1:42793078-42793100 GCCAGCAGAGGAGCTGGAGCTGG - Intronic
906053912 1:42899657-42899679 ACCTCCACTGGAACAGGAGCTGG - Intergenic
906144403 1:43551306-43551328 ACCCCCAGTGGAGCCTGAGCAGG + Intronic
906510447 1:46407668-46407690 GTCCCCAGTGAGGCAGGTGCTGG + Intronic
907490413 1:54805712-54805734 TCCCAAAGTGGAGAAGGAGCTGG + Intergenic
908801473 1:67885040-67885062 GCCCACAGAGGAGATGGAGCTGG + Intergenic
910919520 1:92329015-92329037 ACCTCCACTGGAGCAGGTGCTGG - Intronic
911323284 1:96440226-96440248 GCCTCCACCGGAGCAGGTGCTGG - Intergenic
912591329 1:110824181-110824203 CCCTCCAGTGCAGCAGGTGCTGG - Intergenic
912798714 1:112707496-112707518 GTCCCAGGTGCAGCAGGAGCGGG - Intronic
913436371 1:118851571-118851593 TCCCCCAGTGGAGAAGCAGTGGG + Intergenic
914717073 1:150262219-150262241 GACCCCAGTGCAGGTGGAGCTGG - Exonic
914916455 1:151822281-151822303 CACCACAGGGGAGCAGGAGCGGG + Intronic
915095619 1:153460250-153460272 ACCCTCTGTGGAGCTGGAGCTGG + Intronic
915767112 1:158374188-158374210 GTGCGCAGTGGAGCAGGAGGTGG + Intergenic
920274777 1:204796016-204796038 GATCTCAGTGGAGGAGGAGCAGG - Intergenic
920659442 1:207902844-207902866 GGCCCCAGTGGGTCAGTAGCTGG - Intronic
920771773 1:208893133-208893155 TCCCCCAGTGGAGCAGGGAGAGG - Intergenic
922210214 1:223480663-223480685 GCGCTCTGTGCAGCAGGAGCTGG - Intergenic
922304229 1:224330160-224330182 GCCCCCGGTTGACTAGGAGCTGG - Exonic
922586387 1:226737493-226737515 GCCGGCGGCGGAGCAGGAGCGGG - Exonic
922665667 1:227466468-227466490 GCCCCCAATAGAGCTGGTGCAGG + Intergenic
923021527 1:230167789-230167811 GGCCACAGTGGAGCAGCCGCAGG - Intronic
923318517 1:232805539-232805561 TGCCGCAGTGGAGCAGGAGGAGG + Exonic
1063371142 10:5523868-5523890 ACCCCCAGAGAGGCAGGAGCAGG - Intergenic
1063385560 10:5614196-5614218 GGCCCTAGTGGAACAGGGGCAGG - Intergenic
1066548154 10:36524282-36524304 GCCCGCAGTGGAGAGTGAGCGGG - Intergenic
1067074461 10:43167077-43167099 ACCACCTGTGGAGCAGCAGCTGG + Exonic
1068119889 10:52774637-52774659 TCTGCCACTGGAGCAGGAGCAGG - Intergenic
1068204181 10:53827459-53827481 GCTGCCACTGGTGCAGGAGCCGG + Exonic
1069604690 10:69731899-69731921 GCCCCCAGAGGAGCAGGCCCTGG + Intergenic
1070811131 10:79298621-79298643 CCCCCCAGTGGGCCGGGAGCAGG + Intronic
1070829964 10:79412072-79412094 GCCCCCTGTGGAGGCGTAGCAGG - Intronic
1071527447 10:86366593-86366615 GCCGCCACCGGAGCCGGAGCGGG - Intergenic
1071976838 10:90964149-90964171 GCCCCCAGAGCAGCCTGAGCTGG - Intergenic
1072637594 10:97187627-97187649 GGGCCCCATGGAGCAGGAGCTGG - Intronic
1073098101 10:100992627-100992649 GCCCGCTGTGGAGAAGGAGAGGG + Intronic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1074535937 10:114328722-114328744 GCCCCCAGAGGAGCAGCGTCAGG - Intronic
1075048626 10:119165680-119165702 GCCGCGCGTGGAGGAGGAGCCGG + Intergenic
1075504506 10:123009673-123009695 CCGCCCAGGGGAGCCGGAGCCGG + Intronic
1075992101 10:126846732-126846754 GCCTACAGGGGAGCAGGAGTGGG - Intergenic
1075995511 10:126873468-126873490 TTCCCCAGGGGAGCAGGAGGGGG - Intergenic
1076806371 10:132861194-132861216 AACCACAGTGGGGCAGGAGCCGG - Intronic
1077037490 11:502481-502503 GCCCTCTGTGGGGCAGGAGGAGG - Exonic
1077099993 11:818468-818490 GCCCCCAGTAGGGCTGGGGCAGG + Intergenic
1077100670 11:820967-820989 GCCCATAGTGCAGCAGGTGCTGG + Intronic
1077374534 11:2199345-2199367 GAGCCCAGTGGAGACGGAGCTGG - Intergenic
1077375871 11:2204908-2204930 GCCCCCAGGGCCGTAGGAGCAGG + Intergenic
1077376556 11:2207942-2207964 TCCCTCTGAGGAGCAGGAGCAGG + Intergenic
1078057417 11:8019278-8019300 GCCCCGAGCGGAGCCGGAGGCGG + Intronic
1078105317 11:8354724-8354746 GCTCCCTGAGGAGCAGCAGCTGG + Intergenic
1079189195 11:18263900-18263922 GCCCAGAGTGTAGCAGGAGCAGG - Intergenic
1081091070 11:38867105-38867127 GCCTCCACTGGAGTAGGTGCTGG - Intergenic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1081794624 11:45810972-45810994 GCTCCCCGAGCAGCAGGAGCAGG - Exonic
1081851458 11:46277833-46277855 GCCCCAGGAGGAGCAGGAGGAGG + Exonic
1082104004 11:48200143-48200165 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
1082834105 11:57639526-57639548 GCCCCCAGAGCAGCAGGGGATGG - Intergenic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1083967382 11:66051107-66051129 GCCCCCAGTGGAGAAGAAGCTGG - Intronic
1084484085 11:69437987-69438009 GGCCCCAGTGCAGCAAGAGAGGG - Intergenic
1084607336 11:70180116-70180138 GGGCCCTGTGGAGAAGGAGCTGG + Intronic
1084640192 11:70421065-70421087 GCCCTGAGAGAAGCAGGAGCGGG + Intronic
1085053733 11:73392514-73392536 CCCCCAAGTGGAGCTGGGGCTGG - Intronic
1085384869 11:76151813-76151835 GGCCCCAGGGCTGCAGGAGCAGG - Intergenic
1085389669 11:76175962-76175984 GCCCACAGTGAAGCAGGGGTGGG + Intergenic
1085623030 11:78051347-78051369 GACCAGAGTGGACCAGGAGCAGG - Intronic
1086753539 11:90529738-90529760 GGCCACAGTGGGGCAGGGGCAGG - Intergenic
1087817499 11:102675890-102675912 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1087866074 11:103228567-103228589 ACCTCCAGTGGAGCAGGTGCTGG - Intronic
1088644642 11:111908001-111908023 GGCCCCGGGGGAGCAGGAGATGG - Intergenic
1089214723 11:116828891-116828913 GCCCACAGTGAAGCCGCAGCAGG - Intergenic
1090544427 11:127747346-127747368 GCCCATACTGGAGCTGGAGCTGG + Intergenic
1091755642 12:3049673-3049695 ACACCCTGTGGAGCAGGACCAGG - Intergenic
1092530388 12:9339322-9339344 AGCCCCAGGGGAGCAGGGGCTGG + Intergenic
1093028246 12:14264264-14264286 CCACCCTGTGGAGCTGGAGCTGG - Intergenic
1093687297 12:22071442-22071464 GCATCCAGAGGAGAAGGAGCAGG + Intronic
1095225865 12:39675715-39675737 ACCTCCATTGGAGCAGGTGCTGG + Intronic
1095310522 12:40692564-40692586 GCACCGAGGCGAGCAGGAGCAGG + Exonic
1096846533 12:54410221-54410243 GCCTGCTGTGGAGCAGGGGCAGG + Intronic
1096904165 12:54917503-54917525 CCGTCCAGTGCAGCAGGAGCAGG + Intergenic
1097266946 12:57751581-57751603 GTCCCCAATGGAGGAGGAGGTGG - Exonic
1099286416 12:80717945-80717967 GGCCTCATTGGAGCAGGAACTGG - Intronic
1100508923 12:95249360-95249382 GCCCCCACTGGGGCAAGAGCAGG + Intronic
1101749623 12:107572713-107572735 GTCCCCAGGGAAGCAGAAGCAGG + Intronic
1102036163 12:109771595-109771617 AGCCCCTGGGGAGCAGGAGCCGG + Intergenic
1102492468 12:113297504-113297526 GACCCCAGGGGAGCAGTACCTGG + Exonic
1102876648 12:116454341-116454363 GCCCCAAGTAGAGAAGGAGCTGG - Intergenic
1103815957 12:123656651-123656673 GCTACCAGTGGAGCAGGAAGAGG - Intronic
1103915148 12:124372305-124372327 GCCCCCAGTGGAGGAGGGGGAGG - Exonic
1104020481 12:124988920-124988942 GCCCCCCGTGCAGCTGGAACTGG - Exonic
1104415372 12:128593388-128593410 TCCCTCAGTGGAGCTGGAGCTGG + Intronic
1104770875 12:131363565-131363587 TCACCCAGTGGGGCAGCAGCTGG - Intergenic
1105292580 13:19062200-19062222 GCCCCCAGTGTGGCAGTGGCTGG + Intergenic
1105407091 13:20142100-20142122 GACCCCCGAGGAGGAGGAGCAGG - Exonic
1105962672 13:25356192-25356214 GCCCAGAGTGGGGCAGGAGAAGG + Intergenic
1107701981 13:43057982-43058004 ACCTCCACTGGAGCAGGTGCTGG - Intronic
1108674216 13:52722303-52722325 GCCCCCATAGGAGCAGCTGCAGG - Intronic
1110375920 13:74793979-74794001 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1112299512 13:98217397-98217419 CCCCCCAGGAGAGCAGGGGCAGG + Intronic
1115393159 14:32877051-32877073 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1118140147 14:63071986-63072008 GCCTCCACTGGAGCAGGTGCTGG - Intronic
1118425126 14:65652224-65652246 GCCTTCAGTGGACCAGAAGCTGG + Intronic
1118971639 14:70642405-70642427 GCCCCCCGGGGAACGGGAGCGGG + Exonic
1119261186 14:73238630-73238652 GCCCCCAGCAGAGCAGAGGCAGG + Intronic
1119782882 14:77289556-77289578 GCCCCCACTGGAGCTTAAGCTGG + Intronic
1120493447 14:85204959-85204981 GCGCACAGGGGAGCAGGTGCAGG - Intergenic
1121043827 14:90773792-90773814 GCCTCCAGGGGTGGAGGAGCAGG - Intronic
1121736205 14:96219905-96219927 GCCCTTTGTGGAGCAGGAGAGGG + Intronic
1122436744 14:101706067-101706089 GTCCCCAGCGCAGGAGGAGCCGG + Intergenic
1122786943 14:104168262-104168284 GCCCTCAGTGGTGCAGTTGCTGG + Intronic
1122867178 14:104611760-104611782 CCCCACAGAGGAGCAGGAGCTGG + Intergenic
1122982054 14:105196442-105196464 GCCCCCAGCGCCGCAGGATCTGG + Intergenic
1123032529 14:105458657-105458679 GCTCCCAGTGGCCCAGGAGTGGG - Intronic
1124169582 15:27360669-27360691 GGCTGCAGGGGAGCAGGAGCAGG - Intronic
1124645355 15:31434461-31434483 GCCCCCAGTTGAGCCAGAGTTGG + Intronic
1126190306 15:45871751-45871773 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
1126977366 15:54198471-54198493 ACCTCCAGTGGAGCAGATGCTGG + Intronic
1126997359 15:54460271-54460293 ACCTCCACTGGAGCAGGTGCTGG - Intronic
1127574010 15:60272675-60272697 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1128533453 15:68471075-68471097 GACCTCAGAGGAGCAGGACCAGG + Intergenic
1128875058 15:71194920-71194942 GCCACCAGAGAAGCAGGAACAGG + Intronic
1129233917 15:74212415-74212437 ACCTCCAGCTGAGCAGGAGCTGG - Intergenic
1129508967 15:76106059-76106081 GCCCCCAGTTTAGCGGGATCAGG + Intronic
1129845882 15:78767541-78767563 GCCCCCAGGCCCGCAGGAGCTGG + Exonic
1130255986 15:82326319-82326341 GCCCCCAGGCCCGCAGGAGCTGG - Intergenic
1130598968 15:85263667-85263689 GCCCCCAGGCCCGCAGGAGCTGG + Intergenic
1131235956 15:90697357-90697379 GCCACCAGTGAACCAGGACCTGG + Intergenic
1131529656 15:93180515-93180537 GTCCCCACTGGGGCAGGCGCTGG + Intergenic
1132210715 15:100020229-100020251 GTCCAAAGTGGAGCAGCAGCGGG - Intronic
1132381245 15:101368271-101368293 GGCCCCAGGGGAGCGGGAGAGGG + Intronic
1132600148 16:769553-769575 TCCCCCAGTGCAGCAGGCACAGG + Exonic
1134640826 16:15827954-15827976 GGCCCCAGAGGAGCTGGAGATGG - Intronic
1135315846 16:21443769-21443791 GCAGCCAGTGCAGCTGGAGCAGG + Intronic
1135368772 16:21876030-21876052 GCAGCCAGTGCAGCTGGAGCAGG + Intronic
1135443045 16:22495112-22495134 GCAGCCAGTGCAGCTGGAGCAGG - Intronic
1135887881 16:26328899-26328921 GCACACAGGTGAGCAGGAGCAGG + Intergenic
1136312526 16:29422519-29422541 GCAGCCAGTGCAGCTGGAGCAGG + Intergenic
1136325956 16:29524252-29524274 GCAGCCAGTGCAGCTGGAGCAGG + Intergenic
1136440645 16:30264236-30264258 GCAGCCAGTGCAGCTGGAGCAGG + Intergenic
1137001734 16:35235182-35235204 GCCCCCAGCTGAGAAGCAGCAGG - Intergenic
1137018021 16:35395048-35395070 GCCCCCAGCTGAGAAGCAGCAGG - Intergenic
1137582300 16:49640798-49640820 GCCCCCGGGGGAGAAGGTGCTGG - Intronic
1138192125 16:55022191-55022213 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1139387093 16:66579650-66579672 GCCCCGGGTGGAGGTGGAGCTGG - Exonic
1139467786 16:67163448-67163470 GCTGGCAGTGGAGCTGGAGCTGG + Exonic
1139654527 16:68379246-68379268 GACCACAGTGGAGCAGATGCTGG + Intronic
1139887160 16:70216569-70216591 GCAGCCAGTGCAGCTGGAGCAGG + Intergenic
1141538392 16:84699704-84699726 GCCCCCAGTAGGTGAGGAGCCGG + Intergenic
1141993975 16:87625503-87625525 GCCCCCTGAGCAGGAGGAGCAGG + Intronic
1142120228 16:88383359-88383381 GCCCCCGAGGGCGCAGGAGCGGG - Intergenic
1142330566 16:89449930-89449952 GTGCTCAGTGAAGCAGGAGCTGG - Intronic
1142741420 17:1934026-1934048 GGCCACAGGGGAGCAGGTGCAGG + Intergenic
1143089344 17:4439804-4439826 GGACCCAGTGGGGCTGGAGCTGG - Intronic
1143469337 17:7162013-7162035 CCCCCCAGTGTAGCAGGAGGGGG - Intergenic
1144031241 17:11325186-11325208 CCCAAAAGTGGAGCAGGAGCAGG + Intronic
1145903803 17:28505724-28505746 GCACCCACTGGAGCATGTGCTGG - Intronic
1146369856 17:32258916-32258938 CCCCTCACTGGAGCAGGTGCTGG + Intergenic
1146401718 17:32504926-32504948 GTCGGCAGTGGAGAAGGAGCGGG - Intronic
1146554483 17:33812019-33812041 GCCCACGGTGGTGCAGGAACAGG - Intronic
1146584266 17:34068817-34068839 GCCCTCAGGGGAGCAGGTGGTGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147166804 17:38597880-38597902 GCTGCCAGTGGACCAGGAGGGGG + Intronic
1147486758 17:40822524-40822546 TCCCGCAGTGGAGGAGGAGGAGG - Exonic
1147948528 17:44093820-44093842 GCCCACAGTGGAGGTGAAGCCGG - Exonic
1147968564 17:44207266-44207288 GTCCCCTGAGGAGGAGGAGCTGG + Exonic
1147978940 17:44262984-44263006 GCCCCCTCTGGAGGAGGACCAGG - Intronic
1148068710 17:44893469-44893491 GCTCCCAGTGCAGCTGTAGCTGG + Intronic
1148240963 17:45999061-45999083 GCCCCCAGAGGTGCATGGGCGGG - Intronic
1148715933 17:49715921-49715943 GCCACAAGCGCAGCAGGAGCTGG - Intronic
1148876913 17:50693602-50693624 GCCTCCAGAGGAGCAGCTGCAGG - Exonic
1150620796 17:66806550-66806572 GCCCAGAATGGAGCAGCAGCAGG + Exonic
1151359754 17:73581794-73581816 GCCCCGAGTGGGCCAGGAGTGGG + Intronic
1151441243 17:74130579-74130601 GCCCCGTGCAGAGCAGGAGCTGG + Intergenic
1151507940 17:74541690-74541712 GCTCCAAGAGGACCAGGAGCAGG + Exonic
1151673805 17:75588111-75588133 GGCCTCAGGGGAGCAGGAGTCGG + Intergenic
1151678097 17:75610226-75610248 GCCGCCTCTGGAGCAGGGGCTGG - Intergenic
1152233933 17:79128707-79128729 GTCCCCACAGGAGCAGGGGCAGG - Intronic
1152290550 17:79437550-79437572 GCCCCCAGGCCACCAGGAGCAGG + Intronic
1152426637 17:80221625-80221647 GGCCGCAGGGGAGCAGCAGCAGG - Exonic
1152461013 17:80442429-80442451 GCCACCAGTGTAGCCGCAGCCGG - Intergenic
1152720796 17:81923042-81923064 GCCCCAGGTGAAGCGGGAGCCGG - Exonic
1152816408 17:82410629-82410651 GCCCTCAGCGAAGCAGTAGCTGG - Intronic
1152848854 17:82619453-82619475 GCTCCCTGTGTAGCAGGAGCAGG - Intronic
1153164338 18:2244713-2244735 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
1153396328 18:4625574-4625596 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1153728360 18:7980864-7980886 CCCTCCACTGGAGCATGAGCTGG + Intronic
1155157127 18:23167313-23167335 TCCCCCAGTGGAGAATGATCAGG + Intronic
1156036080 18:32769883-32769905 GCCCCCCGTGGAGTCGGAGCTGG - Exonic
1157416603 18:47508676-47508698 GCCCACAGTGGGGCAGGATTGGG - Intergenic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1159160855 18:64642169-64642191 GCACCCACAGGAGCAGCAGCAGG + Intergenic
1159518361 18:69487432-69487454 GCCCCCAGTGTGTGAGGAGCTGG + Intronic
1159906606 18:74097874-74097896 ACCTCCACTGGAACAGGAGCTGG + Intronic
1160265655 18:77339350-77339372 GCCCCCACTTGTGAAGGAGCTGG - Intergenic
1160329015 18:77975499-77975521 CCCCTCCATGGAGCAGGAGCAGG - Intergenic
1160480705 18:79237320-79237342 GCACACAGTGGGGAAGGAGCAGG - Intronic
1160707632 19:536847-536869 GCCCCCAGAACAGCAGGGGCTGG - Intronic
1160793287 19:932777-932799 GGCCCCACTGGCCCAGGAGCAGG - Intronic
1160874115 19:1289479-1289501 GTCCCCAGGGGAGGAGGAGAGGG - Intronic
1161026794 19:2040650-2040672 GCCTCCAGTCGAGGAGGAGTCGG - Intronic
1161083115 19:2321286-2321308 GCCCCCAAGACAGCAGGAGCTGG - Intronic
1161091052 19:2360226-2360248 CCCCGAAGTGGAGCAGAAGCCGG - Intergenic
1161336150 19:3714711-3714733 TCCCCCAGTGGATCAGGGCCAGG - Intronic
1162137645 19:8565605-8565627 GGGCCTAGTGGGGCAGGAGCAGG + Intronic
1162187014 19:8913725-8913747 ACACCAAGAGGAGCAGGAGCTGG - Intronic
1162565792 19:11445408-11445430 GGCCCAACAGGAGCAGGAGCTGG + Exonic
1162566395 19:11447519-11447541 GCCCACAGAGGAGGAGGAGGAGG + Exonic
1162788717 19:13052120-13052142 GCCCCCAGAGGTGCAAGGGCAGG - Intronic
1162790070 19:13058128-13058150 GGCTCCAGAGAAGCAGGAGCTGG - Intronic
1163019518 19:14474928-14474950 GACCGCAGTGGAGCAGAGGCAGG - Intronic
1163114557 19:15181144-15181166 CCCGCCATTGAAGCAGGAGCTGG + Exonic
1163146145 19:15380223-15380245 GCCCCCAGAGGAGGAGGAGGAGG - Exonic
1163513370 19:17748681-17748703 GTCCCCAGTGCAGCTGGGGCAGG - Intronic
1163815334 19:19461646-19461668 GCCCCTAGTTGAGGAAGAGCTGG + Intronic
1164897647 19:31891139-31891161 GAAGCCAGTGGAGCAGGAGGAGG - Intergenic
1165062216 19:33210493-33210515 GCCTCCAGCGCAGCAGCAGCAGG + Exonic
1166858561 19:45795961-45795983 CCCCACAGTGGAAGAGGAGCAGG - Exonic
1166871357 19:45872866-45872888 GCTCCCAGGGGAGCTGAAGCTGG + Exonic
1168336934 19:55602301-55602323 GCCCCCACTGGTGCAGGTGCAGG + Exonic
924992790 2:328426-328448 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
925134023 2:1514211-1514233 GGCCCCAGTAGAGCAGGAAGTGG - Intronic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
925471907 2:4172245-4172267 GCCCTCAGAGGAGCAGGGCCAGG + Intergenic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
925664412 2:6238042-6238064 GCCCACTGTGGGGCAGGAGGTGG - Intergenic
927054394 2:19356061-19356083 GCACCCAGAGGAGCAGGGGGAGG - Intronic
927176713 2:20415073-20415095 GCCTCCACTGGAGCAGGTGCTGG - Intergenic
927293403 2:21426237-21426259 GCCGCCAGTTGAGCAGGAAGCGG + Intergenic
927492869 2:23532109-23532131 GGCCCCAGTGGAGCGGGTTCTGG - Intronic
928215668 2:29359467-29359489 GCACCCAGTGAAGAAGGAACAGG - Intronic
930448599 2:51505861-51505883 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
932471801 2:71963978-71964000 GCCCACAGTAGAGAAGGAGAAGG - Intergenic
932715788 2:74100178-74100200 ACCCCCAGTGGGGCTGGGGCTGG + Intronic
933246134 2:79976789-79976811 GCCCCAAGTGGGGAAGGAACTGG - Intronic
935503327 2:103869001-103869023 ACCCCCAGTGGAAGTGGAGCGGG - Intergenic
935934347 2:108165778-108165800 GCCCTCAGTAGAGAAGTAGCTGG - Intergenic
936554966 2:113488126-113488148 GCCTCCACTGGAACAGGTGCTGG + Intronic
937521849 2:122721254-122721276 ACCTCCAGTGGAACAGGTGCTGG + Intergenic
937612593 2:123879640-123879662 GCCCAGAGTGGAGCAGGGGTGGG + Intergenic
938186110 2:129233383-129233405 GCTCCCAGTGTGGCAGCAGCTGG - Intergenic
938683980 2:133719088-133719110 GCCCCCAGTGAAACAGGAGCAGG + Intergenic
940034657 2:149301442-149301464 ACCTCCAATGGAACAGGAGCAGG - Intergenic
940423679 2:153508049-153508071 GCCTCCACTGGAGCAGGTGCTGG - Intergenic
940618632 2:156083511-156083533 ACCTCCACTGGAGCAGGCGCTGG - Intergenic
941243993 2:163073888-163073910 CCCCCAAGTGCAGAAGGAGCTGG - Intergenic
941666493 2:168247754-168247776 GCCGCCAGCGGAGCGGGAGCGGG - Exonic
941695257 2:168544470-168544492 GCCCCCAAGAGAGCAGGACCAGG - Intronic
941757435 2:169202832-169202854 GCGCCCATTGGAGCAGGTGAAGG + Exonic
942045454 2:172097003-172097025 GCCCCCGGCGGGGCTGGAGCCGG + Intergenic
944001443 2:194843056-194843078 GCGCACAGTTGAGCAGGTGCAGG - Intergenic
944485441 2:200200219-200200241 TCCTCCACTGGAGCAGGTGCTGG + Intergenic
944605435 2:201347863-201347885 CCCCTCAGGGGAGCAGGGGCGGG - Intronic
945038995 2:205728853-205728875 GCCCCCTGCAGAGCAGGAGCTGG + Intronic
945285654 2:208078775-208078797 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
945968971 2:216217867-216217889 GCCAACTGTGGAGCTGGAGCGGG + Intergenic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
947536823 2:230944990-230945012 GCCCTCCATGAAGCAGGAGCAGG + Intronic
947596956 2:231419016-231419038 GCACACAGTTGAGCAGGTGCAGG - Intergenic
947868777 2:233420466-233420488 GCCCCCAGGGAAGGGGGAGCAGG - Intronic
948148800 2:235728771-235728793 GTGCCTAGTGGAGCAAGAGCGGG + Intronic
948191403 2:236062096-236062118 GCCCACAGGGGAGCGAGAGCAGG + Intronic
948461905 2:238133934-238133956 GCCCCCAGTGGAGACAGAGCAGG + Intergenic
948602435 2:239115094-239115116 GCCCCCACGGGAGGTGGAGCCGG - Exonic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
948809766 2:240468558-240468580 GACCCCACAGGAACAGGAGCGGG - Intergenic
948845967 2:240682976-240682998 GCAGCCAGTGGGGCGGGAGCTGG - Intergenic
948847890 2:240691753-240691775 GCAGCCAGTGGGGCGGGAGCTGG + Intergenic
948854113 2:240722118-240722140 GCCTCCAGTGCAGGAGGCGCAGG + Intronic
1168889232 20:1283298-1283320 GCCCCCAGTAAATCAGGAGTGGG - Intronic
1168973036 20:1943953-1943975 GCCAGCAGTGGGGCAAGAGCTGG + Intergenic
1170727552 20:18943304-18943326 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1171066887 20:22026343-22026365 TCCTCCACTGGAGCAGGTGCTGG - Intergenic
1171408849 20:24932563-24932585 GCCCCCATTATATCAGGAGCTGG - Intergenic
1172306508 20:33884558-33884580 GCCTCTAGTGAAGCAGGAGAAGG + Intergenic
1172317461 20:33967298-33967320 GGCCCCAGTGGCGGGGGAGCTGG - Intergenic
1172591403 20:36120670-36120692 GGACCCAGTGGAGGAGCAGCTGG - Intronic
1172991988 20:39043263-39043285 GACCCCAGGAGAGCAGGAGCTGG + Intergenic
1173248781 20:41353710-41353732 GCTCCCAGAGGGGCAGGTGCAGG - Intronic
1173498524 20:43535849-43535871 GCCCCCAGGGGAGGCAGAGCTGG - Exonic
1173633211 20:44531971-44531993 GACCGCAGGTGAGCAGGAGCCGG + Exonic
1174388361 20:50200638-50200660 GGCCTCAGTGGAGCAGGTGGTGG - Intergenic
1175384167 20:58583696-58583718 TACCCCAGGGGAGCAGGAGCAGG + Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176045935 20:63092567-63092589 GCCCCACGTGGGGCAGCAGCCGG - Intergenic
1176428540 21:6562929-6562951 GCCTCCAGCCGAGCAAGAGCGGG - Intergenic
1179583603 21:42360877-42360899 GCTCACTGTGGAGCAGAAGCTGG - Intergenic
1179704030 21:43171245-43171267 GCCTCCAGCCGAGCAAGAGCGGG - Intronic
1179971292 21:44837730-44837752 GCCCGGCTTGGAGCAGGAGCAGG + Intergenic
1180158667 21:45989558-45989580 ACCCCCGGAGGAGCAGGGGCAGG - Intronic
1181165113 22:20979192-20979214 GTCCCCAGGGCATCAGGAGCAGG + Intronic
1183048565 22:35241688-35241710 GCCCCCAGTGGAGAAGCTGAAGG - Intergenic
1184442064 22:44523046-44523068 GCCGCCAGGGAAGCAGGTGCTGG - Intergenic
1184606017 22:45575334-45575356 GTGCCCAGTGGAGCAGGACATGG + Intronic
1184738393 22:46412379-46412401 ACCCCCAGAAGAGCAGAAGCGGG - Intronic
1184879398 22:47295439-47295461 GCCCCCAGCTGGGAAGGAGCAGG + Intergenic
1184892562 22:47388920-47388942 GCCCCCAGGGCAGCAGGCCCGGG + Intergenic
1185210323 22:49567025-49567047 GCTCACGGTGGAGTAGGAGCCGG + Intronic
1185228674 22:49668015-49668037 GCCCCCAGCTCAGCAGGCGCAGG + Intergenic
949202362 3:1394310-1394332 GGCTCCACTGGAGCTGGAGCTGG + Intronic
949547238 3:5082628-5082650 GCCCCAGGAGGAGCAGCAGCAGG - Intergenic
950418020 3:12879687-12879709 CTCCCCAGTGGAGCAGGGCCTGG - Intergenic
950712051 3:14819827-14819849 GCCCCCTGAGAAGGAGGAGCTGG + Exonic
951262172 3:20523331-20523353 GCCCCCACTGGAGCAGGTGCTGG - Intergenic
952371878 3:32730315-32730337 CCCCCTAGAGGAGAAGGAGCGGG + Intronic
952522351 3:34174377-34174399 ACCTCCACTGGCGCAGGAGCTGG - Intergenic
953453717 3:43025155-43025177 GCCTGCAGAGGAGCAGGAGTGGG + Intronic
953992668 3:47496236-47496258 GTTCCCAGTGGAGCAGGTCCTGG - Intronic
954106577 3:48412786-48412808 GCCCACTGTGGAGCAAGGGCTGG - Exonic
954138257 3:48592222-48592244 GCCCACACAGCAGCAGGAGCTGG - Exonic
954652983 3:52176470-52176492 AGCCACAGTGGAGGAGGAGCTGG - Intergenic
955071463 3:55575693-55575715 GCCACTAGTGGAGCTGGAGAAGG - Intronic
956392164 3:68785400-68785422 GCCCACAGAGGAGCAGGGGAAGG + Intronic
958712587 3:97735990-97736012 GCCAGCAGTGGAGCATCAGCTGG - Exonic
959843699 3:111008523-111008545 TCCCTCAGTGGAGCAAGGGCTGG - Intergenic
961476879 3:127152573-127152595 ACCCCCAGTGGATCTGGAGGAGG - Intergenic
961536400 3:127573442-127573464 GTCCCCAGGGGAGGAGGACCAGG - Exonic
961978031 3:131047654-131047676 ACCTCCACTGGAGCAGGTGCTGG - Intronic
962336490 3:134536235-134536257 GCCCCCAGTTGAGTAGGACTAGG + Intronic
962709483 3:138073328-138073350 ACCTCCACTGGAGCAGGTGCTGG + Intronic
962763957 3:138543646-138543668 GCCAGCAGTGGAGGAGGTGCAGG - Intronic
963014488 3:140809189-140809211 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
963832521 3:150023300-150023322 ACCTCCACTGGAGCAGGTGCTGG + Intronic
964985432 3:162732462-162732484 ACCTCCATTGGAGCAGGTGCTGG - Intergenic
965101637 3:164306303-164306325 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
965911458 3:173782624-173782646 GCCCCCAGGAGAGCAGGAAAGGG + Intronic
966182266 3:177197748-177197770 GCCCCCAGTGCCGCCAGAGCGGG - Intergenic
966229866 3:177640407-177640429 ACCTCCAGTGGAGCAGGTGCTGG - Intergenic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
968288604 3:197522344-197522366 GCCCCCTCTGGCCCAGGAGCTGG - Intronic
968662165 4:1803167-1803189 GCCCCGAGTGGAGCGCGAGCCGG - Intronic
968663184 4:1807174-1807196 GTCCCCTGAGGAGCTGGAGCTGG - Exonic
968703711 4:2068790-2068812 CCCCTCAGTGGAGCAGGGCCTGG + Exonic
968867381 4:3222094-3222116 ACCCCCAGTGGAGCAGACACAGG - Intronic
969036209 4:4255943-4255965 ACTCCCAGGGGAGCAGCAGCAGG + Intergenic
969101088 4:4768700-4768722 GCCCACTATGGAGCAGGGGCCGG - Intergenic
969327467 4:6452205-6452227 GCCCCCAGGCTAGCAGGAGGTGG - Intronic
969709793 4:8836134-8836156 ACCCCCAGTGGTGTGGGAGCTGG - Intergenic
970672790 4:18415573-18415595 GCCCCCTGTGTAGTAGGAGTAGG + Intergenic
971050351 4:22855174-22855196 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
973675991 4:53263628-53263650 GCCTCCACTGGAGCAGGTGCTGG - Intronic
974472151 4:62332050-62332072 ACCTCCAGTGGAGCAGGTGCTGG + Intergenic
974876776 4:67712065-67712087 CACCCCAGGGGTGCAGGAGCTGG + Intergenic
975718278 4:77226826-77226848 ACCTCCACTGGAGCAGGTGCTGG - Intronic
975821006 4:78270419-78270441 GCCTCCAGTGGAGCAGGGCAAGG + Intronic
976786119 4:88823401-88823423 GCCCACTGAGGAGCAGGAGCAGG - Intronic
977826142 4:101533866-101533888 ACCTCCACTGGAGCAGGTGCTGG + Intronic
977929842 4:102738362-102738384 ACCTCCACTGGAGCAGGTGCTGG + Intronic
978269924 4:106876670-106876692 TACCACAGTGGAGCAGGAGAGGG - Intergenic
979308373 4:119174114-119174136 GGGCGCAGTGGAGCAGGAGGTGG - Intronic
981271415 4:142850560-142850582 GGACTCATTGGAGCAGGAGCTGG - Intergenic
982207303 4:153006290-153006312 ACGCCCAGTGGAGGAGGAGAGGG + Intergenic
983277506 4:165636025-165636047 ACCTCCAATGGAGCAGGTGCTGG + Intergenic
983315986 4:166133867-166133889 GCTCCCAGAGCAGAAGGAGCAGG - Intergenic
983546972 4:168975284-168975306 ACCTCCAATGGAGCAGGTGCTGG - Intronic
983656821 4:170091657-170091679 TCCCCCAGTGGAGCCGGCACTGG - Intronic
983985957 4:174060864-174060886 GCCCCAGCTGGAGCTGGAGCTGG + Intergenic
984663592 4:182401059-182401081 GAGTCCAGTGGAGCAGAAGCAGG - Intronic
985355823 4:189117422-189117444 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
985538412 5:476837-476859 GCCCCGAGGGGAGAAGGGGCTGG - Intronic
985903277 5:2813718-2813740 GCCCCTAGTGGATCAGGGCCTGG - Intergenic
987030351 5:13971654-13971676 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
988538198 5:32087412-32087434 GCCCTCAGGGGAGCGGGACCTGG + Exonic
988652325 5:33166460-33166482 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
988929604 5:36024169-36024191 GTCTCCACTGGAGCAGGTGCTGG + Intergenic
988949548 5:36242492-36242514 GCACACGGTGCAGCAGGAGCCGG - Intergenic
989355415 5:40539001-40539023 ACCACCACTGGAGCAGGTGCTGG - Intergenic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
990717064 5:58649167-58649189 GCTCCCAGTGGACCAGCAGGTGG - Intronic
995417587 5:111927182-111927204 GGCCTCAGTGGCGCAGGAGAGGG - Intronic
995647569 5:114329908-114329930 GTGCCCAGTGGAGCAGCAGGAGG - Intergenic
996197871 5:120631996-120632018 ACCTCCACTGGAGCAGGTGCTGG + Intronic
997624052 5:135319699-135319721 GCCCACAGTGGGGCAGATGCAGG + Intronic
997798280 5:136833773-136833795 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1000234388 5:159344222-159344244 GCACACAGGAGAGCAGGAGCAGG + Intergenic
1000305024 5:159987078-159987100 GCCCCCAGCGGCGGGGGAGCCGG + Intergenic
1001281779 5:170391212-170391234 TCCCCCAGGGAAGCAGGAGGGGG - Intronic
1001415380 5:171541787-171541809 GCCCCGGTTGGAGCTGGAGCTGG + Intergenic
1002191299 5:177479170-177479192 GCCTAGAGTGGGGCAGGAGCAGG - Intergenic
1002458429 5:179359661-179359683 ACCCCCAGGGGAGCAGCACCTGG - Intergenic
1003181783 6:3798430-3798452 GCACCCAGTTGAGTAGCAGCTGG + Intergenic
1003307484 6:4942852-4942874 GCCCTCAGTGGAGCAGGATGTGG + Intronic
1006510023 6:34516562-34516584 ACCTCCACTGGAGCAGGGGCTGG + Intronic
1008042226 6:46814923-46814945 ACCTCCACTGGAGCAGGTGCTGG - Intronic
1008109637 6:47478183-47478205 GCCACCACTGGAGGAGGAGGAGG + Exonic
1008250840 6:49238038-49238060 ACCTCCACTGGAGCAGGTGCAGG - Intergenic
1008250856 6:49238120-49238142 ACCTCCACTGGAGCAGGTGCAGG - Intergenic
1008528559 6:52433556-52433578 ACCTCCACTGGAGCAGGTGCTGG - Intronic
1008781312 6:55109010-55109032 ACCTCCACTGGAGCAGGTGCTGG + Intronic
1008992482 6:57619034-57619056 GCCTCCAATGGAACAGGCGCTGG + Intronic
1009389646 6:63130542-63130564 GCCTCCACTGGAACAGGTGCTGG - Intergenic
1011965809 6:93156456-93156478 TCCTCCACTGGAGCAGGTGCTGG - Intergenic
1012869899 6:104659972-104659994 ACCCCCACTGGAGCAGGTGCTGG + Intergenic
1014788522 6:125644781-125644803 GGCACCAGTGGAGCAGGGGGTGG - Intergenic
1015928704 6:138335124-138335146 GCTCCCGGTGGAGCCTGAGCGGG - Exonic
1016910074 6:149190157-149190179 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1017003006 6:150008776-150008798 GTCCCCAGTGGCACAGGTGCTGG + Intergenic
1017012571 6:150072442-150072464 GTCCCCAGTGGCACAGGTGCTGG + Intergenic
1017108018 6:150906406-150906428 GCCCCGGGTCCAGCAGGAGCCGG + Intronic
1018596789 6:165489208-165489230 ACCTCCACTGGAGCAGGTGCTGG + Intronic
1018755342 6:166843531-166843553 ACCTCCACTGGAGCAGGTGCTGG + Intronic
1019327525 7:445689-445711 GCCCGCAGTGGGGAAGGGGCAGG - Intergenic
1019455881 7:1127264-1127286 GCACCAAGTGGCGAAGGAGCCGG - Exonic
1019517712 7:1447088-1447110 GCCCCTAATGGGGCAGGAGGAGG - Intronic
1019643516 7:2117013-2117035 GCTCCCAATGCAGCAGGAGAGGG + Intronic
1019702356 7:2480136-2480158 GCCCCCGCTGGAGGAGGCGCGGG + Intergenic
1020098738 7:5382630-5382652 GCCCCCTGTGAAGCTGGAGGTGG + Intronic
1020162082 7:5780895-5780917 GCTCCCGGTGGAACAGGACCAGG - Intronic
1020212624 7:6167499-6167521 GGCACCAGTGCAGCTGGAGCGGG - Intronic
1020373752 7:7461989-7462011 TCACCCACTGGAGCAGGCGCTGG + Intronic
1021340181 7:19455458-19455480 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1021610630 7:22454578-22454600 GCCCCAAGTGCTACAGGAGCTGG + Intronic
1022517736 7:30986762-30986784 GCCCCCAAAGGAGGCGGAGCAGG + Intronic
1024327988 7:48127402-48127424 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1024455821 7:49605331-49605353 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
1024840079 7:53575230-53575252 ACCTCCACTGGAGCAGGGGCTGG + Intergenic
1024933545 7:54689481-54689503 GCCACCTGTGGAGTAGGAGGAGG - Intergenic
1027219106 7:76202543-76202565 GCCCCTAGGGAGGCAGGAGCTGG + Intronic
1028648028 7:93119965-93119987 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
1030160702 7:106505621-106505643 ACCCCCAGTGGAGCTGGAAAAGG + Intergenic
1031261422 7:119525460-119525482 GCCTCCACTGGAGCAGATGCTGG + Intergenic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1032082824 7:128868667-128868689 CCCCCCAGTGAAGCAAGAACTGG + Intronic
1032448861 7:132009567-132009589 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1032931582 7:136678376-136678398 GCCTCTATTGGAGCAGGTGCTGG + Intergenic
1033622954 7:143078311-143078333 ACCTCCATTGGAGCAGGTGCTGG + Intergenic
1033981171 7:147167466-147167488 ACCTCCAGTGGGGCAGGGGCAGG - Intronic
1034166411 7:149028366-149028388 GCCCCAAGAGCAGCAGGAGCAGG + Exonic
1034345627 7:150383769-150383791 GCTGCTAGTGGAGCGGGAGCAGG - Intronic
1034359563 7:150482187-150482209 GCACCCAGTGGAGAAGGATTTGG - Intergenic
1034413786 7:150954742-150954764 GCCGACAGTGGAGGAGGAGTGGG - Intronic
1034705431 7:153139190-153139212 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1035521622 8:279185-279207 GATCCAAGTCGAGCAGGAGCAGG - Intergenic
1035685003 8:1517450-1517472 GCTCTCAGTGGAGCAGGGGGTGG - Intronic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1037291603 8:17356010-17356032 GCATCCAGTGGTGCTGGAGCAGG + Intronic
1037438463 8:18889464-18889486 GCCCCCAGTTGTCCAGGACCTGG - Intronic
1039763874 8:40607909-40607931 GCCTCCACTGGAGCGGGTGCTGG - Intronic
1039798669 8:40936155-40936177 GACCCCAGGGGAGTGGGAGCAGG + Intergenic
1041763597 8:61393785-61393807 ACCTCCACTGGAGCAGGTGCTGG - Intronic
1042982977 8:74551303-74551325 TCCTCCAGTGGAACAGGGGCAGG - Intergenic
1043048108 8:75352698-75352720 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
1046219272 8:111192480-111192502 GGCATCAGTGGAGCAGGAGAGGG + Intergenic
1046396832 8:113651157-113651179 GCTCCCAGTGGAAGGGGAGCTGG - Intergenic
1047227269 8:122967528-122967550 ACCTCCACTGGAGCAGGTGCTGG - Intronic
1047901824 8:129431440-129431462 GCCTCCACTGGAGCAGGTGCTGG - Intergenic
1048174049 8:132135459-132135481 GCCGTCAGTGGAGGAGCAGCTGG - Intronic
1048228258 8:132611737-132611759 GCCGCCAAGGAAGCAGGAGCTGG - Intronic
1048328345 8:133455484-133455506 CACCCCAGGGGTGCAGGAGCTGG + Exonic
1048878242 8:138853249-138853271 GGCCCCATTGGAGCAGGTTCAGG + Intronic
1049164608 8:141118184-141118206 GGCCCCAGTGGTGTAGGTGCCGG - Intronic
1049298117 8:141854686-141854708 GCCCCCAGAGGAGCAGGTGTTGG - Intergenic
1049576957 8:143393939-143393961 GCCCCCTGGGGAGCTGGGGCAGG + Intergenic
1049667447 8:143852557-143852579 GCAGCCAGTGGAGCAGGGCCAGG + Intergenic
1049869724 8:144965349-144965371 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1049898040 9:129058-129080 GCCTCCACTGGAACAGGTGCTGG - Intronic
1051687635 9:19675233-19675255 ACCTCCACTGGAGCAGGTGCTGG - Intronic
1052253674 9:26428079-26428101 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
1052865107 9:33460123-33460145 CTCCCCAGTGGAACTGGAGCAGG + Intergenic
1053016475 9:34665162-34665184 GCACCCCGGGGAGCAGAAGCTGG - Exonic
1053557664 9:39154702-39154724 TCCCCCAGTGAAGGAGGAACAGG + Intronic
1053821780 9:41974990-41975012 TCCCCCAGTGAAGGAGGAACAGG + Intronic
1054139450 9:61464249-61464271 TCCCCCAGTGAAGGAGGAACAGG - Intergenic
1054608790 9:67212418-67212440 TCCCCCAGTGAAGGAGGAACAGG - Intergenic
1057226050 9:93293722-93293744 CCCCCAAGTGCAGCAGGAGGAGG - Intronic
1057267785 9:93630423-93630445 GCCCCCCGTGTAGCAGTGGCTGG - Intronic
1057998069 9:99838512-99838534 GCCCACAGAGGGGCAGGAACTGG - Intronic
1058784499 9:108374124-108374146 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1060311129 9:122463805-122463827 ACCTCCATTGGAGCAGGTGCTGG - Intergenic
1060587458 9:124795411-124795433 GCCCCCAGTGCACCAAGATCAGG + Intronic
1060629566 9:125143438-125143460 TCCCGCGGCGGAGCAGGAGCCGG - Exonic
1060957445 9:127652793-127652815 GCCCACAGTGGAGAGGAAGCTGG - Intronic
1061178644 9:129011683-129011705 GCCCCCAGGGGAGTTGGGGCAGG - Intronic
1061297739 9:129686152-129686174 GCACCCAGTGAAGCTGGAGGGGG + Intronic
1061623659 9:131827768-131827790 GCAGCCTGGGGAGCAGGAGCGGG + Intergenic
1062383166 9:136297489-136297511 GCCACCACTGGAGCAGCAGGTGG - Intronic
1062432059 9:136530631-136530653 TCCCGCAGTGGAGCAGCAGGTGG - Intronic
1062451710 9:136618512-136618534 GCCCCTCGAGGCGCAGGAGCTGG + Intergenic
1062543535 9:137051959-137051981 GCCCCAGATGGAGCAGGAGGAGG - Intronic
1062547625 9:137070742-137070764 GGCCAGAGTGGAGCAGGAGCTGG - Intergenic
1203779974 EBV:95914-95936 ACCCACGGTGGAACAGGAGCAGG + Intergenic
1187748438 X:22433954-22433976 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
1188430569 X:30102203-30102225 GAGGCCAGTGGAGCTGGAGCAGG - Intergenic
1188725636 X:33578533-33578555 GCCTTCAGTGGAGCATGACCAGG - Intergenic
1189488013 X:41447479-41447501 GACCTCAGAGGAGCAGGACCAGG + Exonic
1189567257 X:42255409-42255431 GCCTCCACTGAAGCAGGTGCTGG + Intergenic
1190385489 X:49879491-49879513 GCCGCCAGTGGAGGCGGAGGAGG + Intergenic
1190598936 X:52069993-52070015 GTCCCCAGGCCAGCAGGAGCAGG - Intergenic
1190609888 X:52184080-52184102 GTCCCCAGGCCAGCAGGAGCAGG + Intergenic
1191797288 X:65034829-65034851 GGCGCCAGAGGAGGAGGAGCAGG + Intergenic
1191888871 X:65920251-65920273 ACCTCCACTGGAGCAGGTGCAGG - Intergenic
1192895577 X:75440047-75440069 ACCTCCACTGGAGCAGGTGCTGG - Intronic
1192900104 X:75487291-75487313 ACCTCCAGTGGAGCAGGTGCTGG + Intronic
1194076363 X:89399686-89399708 ACCTCCATTGGAGCAGGGGCTGG - Intergenic
1194165407 X:90508421-90508443 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
1194532870 X:95072340-95072362 GCCTCCACTGGAGCAGGTGCTGG + Intergenic
1195231916 X:102859127-102859149 ACCTCCACTGGAGCAGGCGCTGG - Intergenic
1195972766 X:110491642-110491664 ACCTCCAGTGGAGCAGGTGCTGG - Intergenic
1196741558 X:119029842-119029864 GGCGCCAGTGGAGCAGGGGGTGG - Intergenic
1196949057 X:120857642-120857664 GCCTCCACTGGAGCAGGTGCTGG + Intergenic
1197034600 X:121859012-121859034 ACCCCCACTGGAGCAGGTGCTGG - Intergenic
1197055438 X:122113474-122113496 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1197769734 X:130082455-130082477 GCCCCGACTGGAGGAGGGGCAGG + Intronic
1198267499 X:135022654-135022676 GCACCCAGCGGAGCAGGTGGTGG + Intergenic
1198604486 X:138322128-138322150 ACCTCCACTGGAGCAGGTGCTGG - Intergenic
1199700954 X:150375181-150375203 GCCCAGAGAGGAGCAGGTGCTGG + Intronic
1199913787 X:152316128-152316150 ACCTCCACTGGAGCAGGTGCAGG + Intronic
1200150661 X:153949878-153949900 AGCCCCAGGGGAGCTGGAGCAGG + Intronic
1200429003 Y:3055206-3055228 ACCTCCATTGGAGCAGGGGCTGG - Intergenic
1200511675 Y:4086231-4086253 ACCTCCACTGGAGCAGGTGCTGG + Intergenic
1201074429 Y:10175995-10176017 TCCCCCAGTGGCGCCGGATCTGG + Intergenic