ID: 1083904055

View in Genome Browser
Species Human (GRCh38)
Location 11:65658717-65658739
Sequence CTGTGTGACAAGGTGCAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083904055_1083904064 29 Left 1083904055 11:65658717-65658739 CCTTTCTGCACCTTGTCACACAG 0: 1
1: 1
2: 2
3: 16
4: 226
Right 1083904064 11:65658769-65658791 TGCCAGAGTTTCGGTTCACTCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1083904055_1083904063 20 Left 1083904055 11:65658717-65658739 CCTTTCTGCACCTTGTCACACAG 0: 1
1: 1
2: 2
3: 16
4: 226
Right 1083904063 11:65658760-65658782 CGAGGCAGCTGCCAGAGTTTCGG 0: 1
1: 0
2: 1
3: 8
4: 210
1083904055_1083904058 2 Left 1083904055 11:65658717-65658739 CCTTTCTGCACCTTGTCACACAG 0: 1
1: 1
2: 2
3: 16
4: 226
Right 1083904058 11:65658742-65658764 GGAAGATCTCATCCCCACCGAGG 0: 1
1: 0
2: 1
3: 9
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083904055 Original CRISPR CTGTGTGACAAGGTGCAGAA AGG (reversed) Exonic
900317735 1:2067777-2067799 CTGTGTGACCAGATACAGCAAGG - Intronic
900588384 1:3445008-3445030 GTGGGTGGCAAGGAGCAGAAAGG + Intergenic
900888057 1:5429440-5429462 ACCTGTCACAAGGTGCAGAAAGG + Intergenic
901204488 1:7486129-7486151 CGGTGTGACAGTTTGCAGAATGG + Intronic
901427627 1:9192596-9192618 CGGTGTGGCAAGGTAGAGAAGGG - Intergenic
902767821 1:18629001-18629023 CTGTGTGTCAAGGTGCAGGTGGG - Intergenic
903450913 1:23453029-23453051 CTGTGTGAAAGGGGGCAGGAGGG + Intronic
903541445 1:24098630-24098652 CTGAGTGACCAGGGGCAAAAAGG - Intronic
903731796 1:25501877-25501899 CTGGGTGACATGATGCAAAAGGG + Intergenic
904602043 1:31678873-31678895 CTGTGTGACACTGTGAATAAAGG - Intronic
905265805 1:36753668-36753690 CGGTGTGGCCATGTGCAGAAGGG + Intergenic
905471567 1:38196096-38196118 CTGTGTGACTGGGTGCCAAATGG + Intergenic
905853434 1:41291007-41291029 CTGAGTGACAAGGTCCAGGAAGG - Intergenic
906256975 1:44357853-44357875 CTGTGTGACAGGGAGAAGGAAGG + Intergenic
906284191 1:44575924-44575946 CTGTGTGACATGCTCCATAATGG + Intronic
906312352 1:44762842-44762864 ATGTGTGCCAACCTGCAGAAGGG - Intronic
907300763 1:53485157-53485179 GTCTGTGAGAAGCTGCAGAAGGG + Intergenic
907657239 1:56356692-56356714 CTAGCTGACAAAGTGCAGAAAGG + Intergenic
909053051 1:70790639-70790661 CTGTGGGACAACCTGCAGAGTGG + Intergenic
912948708 1:114105842-114105864 ATGTAAGCCAAGGTGCAGAAGGG - Intronic
913104137 1:115596025-115596047 CTGTCTGACAGGGTGCAGGAGGG - Intergenic
914293190 1:146293886-146293908 CTGTGGGCCAAAGTGCAGGAGGG - Intergenic
914554234 1:148744669-148744691 CTGTGGGCCAAAGTGCAGGAGGG - Intergenic
915545473 1:156594765-156594787 CTGGGTTAGAAGCTGCAGAAAGG + Intronic
920240959 1:204550077-204550099 CTGTCTGAAGAGGGGCAGAAGGG - Exonic
921600952 1:217105723-217105745 CTGATTGTCCAGGTGCAGAATGG - Intronic
924766371 1:247034706-247034728 GTGTGTGTGAAGTTGCAGAAAGG - Intergenic
1063712407 10:8492447-8492469 CAGTGTGACAAGGTTAAGACAGG - Intergenic
1065700573 10:28421276-28421298 CTGTGTGCCCAGGTGTGGAATGG + Intergenic
1068577299 10:58698550-58698572 CTGTGTGCCATGTTTCAGAATGG - Intronic
1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG + Intergenic
1072726630 10:97817977-97817999 ATGTGTGACAAGGTGCTGGTAGG + Intergenic
1073287584 10:102398064-102398086 CTTTGTGACAAGGTGCAGAAAGG + Exonic
1073838607 10:107472440-107472462 CAGTGTGACCAGTTTCAGAAAGG - Intergenic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074326199 10:112454055-112454077 CTGTGTAACATGGTATAGAATGG - Intronic
1074894211 10:117760945-117760967 CTGTGTGGCATCGGGCAGAAGGG + Intergenic
1077102588 11:828725-828747 CTGTGTGACAAGGAGGCTAAGGG + Exonic
1077578176 11:3400012-3400034 CTATGTGACAGAGTGAAGAAAGG - Intergenic
1078637404 11:13064780-13064802 CTGAGTGCCAAAGTGCCGAAAGG - Intergenic
1083261241 11:61524243-61524265 CTGTGGGAGAGGGTGCAGATGGG - Intronic
1083904055 11:65658717-65658739 CTGTGTGACAAGGTGCAGAAAGG - Exonic
1084232916 11:67766185-67766207 CTATGTGACAGAGTGAAGAAAGG - Intergenic
1084321652 11:68376736-68376758 CTGTGTGCCTGGGTTCAGAAAGG + Intronic
1087952772 11:104244124-104244146 CTGTGTGATAAGGTGAATAATGG - Intergenic
1088191393 11:107232659-107232681 CCATGTGACCAGTTGCAGAAAGG - Intergenic
1088579424 11:111300465-111300487 CTGGGTGCCAGGGTGCAGAGTGG - Intronic
1091485197 12:879892-879914 CTGAGTCACAGGCTGCAGAAGGG - Exonic
1096188318 12:49598632-49598654 CTGCGGGACCAGGGGCAGAAGGG - Intronic
1099300900 12:80893183-80893205 GTGTGTAACATGGTGCTGAATGG + Intronic
1100784195 12:98062022-98062044 CTGTCTGCCCAGATGCAGAAAGG + Intergenic
1101824412 12:108209547-108209569 CTATGTGAGTAGGTGTAGAAGGG + Intronic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1103049078 12:117763657-117763679 CTGTGGGCTAAGGTGCAGATTGG + Intronic
1103696223 12:122817917-122817939 CAGGGTGCCAAGGTGGAGAAGGG - Intronic
1106862005 13:33920057-33920079 CCCTGTGAGAGGGTGCAGAAGGG - Intronic
1107758886 13:43655022-43655044 CTGTGTCACAGAGTGAAGAAAGG - Intronic
1110300202 13:73917383-73917405 CTGATTTACAAGGTGTAGAAGGG - Intronic
1110585361 13:77184667-77184689 CTCTGTGACTTGGTGCATAAAGG + Intronic
1110695006 13:78477780-78477802 ATGTTTGACAAAGTGAAGAATGG - Intergenic
1111166171 13:84460518-84460540 ATGTGTTACAAGGAGGAGAAGGG - Intergenic
1112686437 13:101833163-101833185 CTGTTTAGAAAGGTGCAGAATGG - Intronic
1114453590 14:22841805-22841827 CTGTGTGTCAATGTGGGGAAAGG - Intronic
1114883757 14:26821371-26821393 CTGTATGGCAAGGAGCACAATGG + Intergenic
1117897640 14:60505186-60505208 CTTTGTTACAAGGTGCACAATGG + Intronic
1118002937 14:61540494-61540516 CTGTGTGACAGGTTACAGATGGG + Intronic
1118778657 14:68991166-68991188 CTGTGAGACAAGGTGTATTAGGG + Intergenic
1119704505 14:76775513-76775535 GTGTGTGCCAAGGTGCGGGATGG + Intronic
1120110506 14:80549116-80549138 TTTTGGGACAAGGTGGAGAAAGG + Intronic
1120110835 14:80553886-80553908 CTGTTAGACACTGTGCAGAAGGG - Intronic
1120384854 14:83831877-83831899 TTGGGGGACAATGTGCAGAATGG + Intergenic
1120716487 14:87846407-87846429 CAGTGTGACAAGAGACAGAAAGG + Intronic
1120863867 14:89278613-89278635 CTGGGTGAGAAGGTGCAGTTTGG - Intronic
1122121420 14:99555466-99555488 CTGTGTGCCAGGGAGGAGAAGGG - Intronic
1127320822 15:57844289-57844311 CTATGTGACAAGATGAAGTAAGG + Intergenic
1128331347 15:66757590-66757612 CTGTGGGACAAGGGCCAGAAGGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1132149638 15:99450537-99450559 CTGTGTGAGAACGTGAATAAAGG + Intergenic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1132245787 15:100295239-100295261 CTGGGAGACAAGAGGCAGAATGG - Intronic
1132367335 15:101267039-101267061 CTGTTTGCCAGGGTGCAGACAGG - Intergenic
1133035204 16:3030522-3030544 CTGCGTGAGGAGGTGGAGAAGGG - Exonic
1133560333 16:6944716-6944738 ATGTATGTCAAGGGGCAGAAAGG - Intronic
1133613054 16:7451056-7451078 CTGAGTGACAAGGAGGAGACTGG + Intronic
1134624367 16:15713477-15713499 CTGTGGGAAAAGGTGGAGAGTGG + Intronic
1135520451 16:23172838-23172860 CTGTGTGGCAAGGACCAGGAAGG + Intergenic
1136452642 16:30362367-30362389 CTGTGTGAAATGCTGCTGAAGGG - Intronic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1140015621 16:71179916-71179938 CTGTGTGCCAAGGTGCCCCAGGG - Intronic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1145787195 17:27601870-27601892 CTGTGTGGTAAGGCACAGAAGGG - Intronic
1146918732 17:36695509-36695531 CTGTGTGATAGGGTGGGGAAGGG + Intergenic
1147607840 17:41784542-41784564 CTCTGTGCCAAGGTGGAGGAGGG - Intronic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1151425700 17:74029786-74029808 CTGTGTGATCAGGAGAAGAAAGG + Intergenic
1153091249 18:1346460-1346482 GTGAATGACAAAGTGCAGAATGG + Intergenic
1154086581 18:11311333-11311355 CACTATGACAAGGTGCTGAAGGG + Intergenic
1154957979 18:21277743-21277765 CGGTATGACAGGGTGCAGCACGG - Intronic
1155194578 18:23461405-23461427 CTGTGTTACAGTGTGAAGAATGG + Intronic
1157474633 18:48014009-48014031 CAGTGTGATAAGGTACAGTATGG - Intergenic
1159498720 18:69240097-69240119 GAGTGAGACAAGGTGAAGAAGGG + Intergenic
1159976740 18:74722553-74722575 CTCTGTGCCAAGGTGAGGAAGGG - Intronic
1163647688 19:18499333-18499355 CTGTGTGACAAAGCCCAGAGAGG - Intronic
1165316678 19:35060324-35060346 CTGTGGGACAAGGGTCAGCAGGG - Intronic
1165387532 19:35519623-35519645 ATGTCTGGCAAGGAGCAGAAGGG - Intergenic
1165555009 19:36623104-36623126 CTCTGTTACAAGCTGCAGTAAGG - Intronic
1165601027 19:37056116-37056138 CTGTGTGGCAGGGAGCCGAAGGG + Intronic
1166726144 19:45028971-45028993 CTCTGCGACAAGGTGCAGAAAGG + Exonic
924961164 2:35754-35776 CAGTGTGCCAAGGCCCAGAAGGG - Intergenic
926132117 2:10310074-10310096 CTGTTTGCTCAGGTGCAGAAAGG + Intronic
926305909 2:11637112-11637134 CAGTGGGTGAAGGTGCAGAAGGG + Intronic
926805285 2:16704816-16704838 CTGTTGGACAAGGAGCAGGATGG - Intergenic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
929495383 2:42437140-42437162 CTGTGGTACAAGGTGGAGATAGG - Intergenic
930308623 2:49709278-49709300 CTGTGTCAAATGGTGCAGAAAGG - Intergenic
931295299 2:60918274-60918296 CTTTGTGACAAAGTTCAGAAAGG + Exonic
931381265 2:61755656-61755678 CTTGGAGACAAGGTGAAGAAAGG - Intergenic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
931502578 2:62886175-62886197 CTGTGTAAAACTGTGCAGAATGG + Intronic
937756315 2:125542909-125542931 CTGTGAGACAATGTGAAGACAGG - Intergenic
938087338 2:128410072-128410094 CTGGGTGGCAAGGTCCAGCACGG + Intergenic
939678925 2:145106715-145106737 TTTTGTGAAAAGGTGAAGAATGG - Intergenic
940808464 2:158215441-158215463 CTGTATGCCATGGTTCAGAAGGG + Intronic
941464084 2:165804829-165804851 GTGTTTCACAAGATGCAGAAAGG - Intergenic
943787243 2:191891711-191891733 CTGTCTGCCTTGGTGCAGAAAGG - Intergenic
946509990 2:220345638-220345660 CTGTGGGAAAAGGTGAAGAGAGG - Intergenic
946683975 2:222248368-222248390 TTGTGTGAAGATGTGCAGAAAGG - Intronic
946715862 2:222554706-222554728 TTGTGTGGGAAGGTGGAGAAGGG + Intronic
1169591633 20:7149172-7149194 ATGTGAGACATTGTGCAGAATGG - Intergenic
1169626598 20:7578310-7578332 CTGTGTGACCAGTTACAGAAAGG - Intergenic
1170530256 20:17284139-17284161 CTGTGTGAGATGGCCCAGAAAGG + Intronic
1170534324 20:17324956-17324978 CTGTGTGGCAAGGAGAAGCATGG - Intronic
1170764115 20:19275506-19275528 CTGTGGGACAAGGTTCACATAGG + Intronic
1172693399 20:36805520-36805542 CTGTGTGCCAAGGTGTGGCAAGG - Intronic
1172699039 20:36841575-36841597 CAGTGTGTCAAGGTACAGCAAGG + Intronic
1173174768 20:40756162-40756184 TTGTGTGACAAGATGCAAAGAGG - Intergenic
1173296798 20:41766868-41766890 CTGGGTTAGATGGTGCAGAAGGG + Intergenic
1174554349 20:51383130-51383152 CTGTTTGACAAGGTGAATAACGG - Intergenic
1174756853 20:53167510-53167532 CTTTGTGTCAGGGTGGAGAATGG + Intronic
1175456608 20:59120116-59120138 ATGGGTGACAGGGTGCAGATCGG + Intergenic
1175744311 20:61443527-61443549 CTGTGTGATCAGGAGAAGAAAGG - Intronic
1179463805 21:41557327-41557349 CTGTTTTAAAAGGTGTAGAATGG + Intergenic
1182700155 22:32230227-32230249 CTGTGTGTCAGGGTGGAGGAAGG + Intronic
1182873582 22:33670487-33670509 CTGTGTGCCAAGGTGCCCCAGGG + Intronic
1183380629 22:37488931-37488953 GTCTTTGACAAGGTGCAGATTGG - Intergenic
1184238306 22:43198287-43198309 CTGAGTGGCATGGTGCAGCAGGG + Exonic
1184739707 22:46420839-46420861 CTGTGTGATAAGGTGAAGGTGGG + Intronic
1184858096 22:47157533-47157555 CTGCGAGGCCAGGTGCAGAATGG - Intronic
951134924 3:19094329-19094351 CTGTGTGTCAAGGGTCAGAGGGG + Intergenic
951614443 3:24525536-24525558 CTGTATGACAAGGAAGAGAAGGG + Intergenic
952685550 3:36143882-36143904 ATGTGTGCAAGGGTGCAGAAGGG - Intergenic
954301094 3:49701227-49701249 CTGTGGGACAAGCTGGAGAGAGG - Intronic
954395221 3:50289880-50289902 CTGAGGGATAAGGTGCAGGAAGG + Intronic
956595305 3:70960580-70960602 CTCTGGGACAGGCTGCAGAAGGG + Intronic
960557341 3:119043782-119043804 CTGGGTGGCTAGATGCAGAAGGG + Intronic
961439529 3:126944693-126944715 CTGTGTGACAGCGGGAAGAAGGG + Intronic
961881665 3:130065788-130065810 CTATGTGACAGAGTGAAGAAAGG - Intergenic
962220892 3:133563921-133563943 CTGTGTCCCAATGTGCAGCAAGG + Intergenic
962578095 3:136772965-136772987 CTGACTGACAGGGTGCAGACGGG + Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
963623054 3:147635744-147635766 CTGGGTGGCTAGATGCAGAAGGG + Intergenic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
966734135 3:183175609-183175631 CTGGGTCACAGGGTTCAGAAAGG - Intergenic
968384928 4:127252-127274 TTGTATGACAAAGTGCAGCAAGG + Intronic
968641081 4:1715371-1715393 CTGTGGGTCAAGAAGCAGAATGG + Intergenic
968993983 4:3933897-3933919 CTATGTGACAAAGTGAAGAAAGG - Intergenic
969822246 4:9729689-9729711 CTATGTGACAGAGTGAAGAAAGG + Intergenic
970190602 4:13512572-13512594 CTGGAAGAAAAGGTGCAGAAAGG - Intergenic
971007429 4:22390978-22391000 GTGTTTGACAAGGAGCAGCAGGG - Intronic
972581997 4:40403275-40403297 CTGTGGGACAAGGAGCAAACTGG - Intergenic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
976135029 4:81926535-81926557 CGGTGTCACAAGCTGCAAAATGG - Intronic
977680376 4:99792326-99792348 CTGTCCGCCAAGGTGCAGAGAGG + Intergenic
977914912 4:102580618-102580640 CTTTGTGACAAAGTTCAGAAAGG + Exonic
980629784 4:135416282-135416304 CTACGTGACCAGTTGCAGAAAGG + Intergenic
981285324 4:143010836-143010858 CTATGTGACAAGGAACACAAGGG - Intergenic
983329269 4:166303519-166303541 CTGCTTGAAAAGATGCAGAATGG + Intergenic
984651148 4:182271887-182271909 CTGTGAGAGCAGGTGCAGCAGGG + Intronic
986464944 5:8011760-8011782 CTGTGTGAGAGGGTGCGAAATGG + Intergenic
987129928 5:14850785-14850807 ATTTGTGAAAAGGTGCTGAAAGG + Intronic
987269971 5:16297150-16297172 CAGAGTGACAAGGTGGATAAAGG - Intergenic
987377775 5:17252454-17252476 CTGTGTGCCATGCAGCAGAAAGG + Intronic
988424962 5:31053441-31053463 CTTTGTGACAAGGTACTGAGAGG + Intergenic
995404488 5:111779327-111779349 CTGTGTGACAGGATGCACACTGG - Intronic
996088606 5:119328609-119328631 CTGAGTGACAAGGTTGTGAAGGG + Intronic
998498906 5:142614869-142614891 CTATGTGGAAAGCTGCAGAATGG - Intronic
998798474 5:145843656-145843678 CTGGGTGACAAGCCTCAGAAAGG + Intergenic
999105196 5:149064424-149064446 TTGGGTGACCAGGTGAAGAATGG + Intergenic
1000925182 5:167185282-167185304 CTTAGTTTCAAGGTGCAGAAGGG - Intergenic
1004062189 6:12208520-12208542 CTGGGTGACGCGGTGCAGCACGG - Intergenic
1004375528 6:15087610-15087632 CTGTGAGACAGGATTCAGAAAGG - Intergenic
1005077438 6:21922208-21922230 CTGTGTGACTTGGTGCAGGCAGG - Intergenic
1006290203 6:33129142-33129164 CAGTGTCACAATGTACAGAAAGG - Intergenic
1007305771 6:40903040-40903062 CAGTGTGCCAAGGTGCTGCAGGG - Intergenic
1008040952 6:46797615-46797637 CTTTGGGACAAGAGGCAGAATGG + Intronic
1008527310 6:52419903-52419925 CTGTGTGAAATGGGGCAGAGGGG + Intergenic
1008627364 6:53330899-53330921 CAGTGGGACAAGATGTAGAAGGG - Intronic
1011684112 6:89810606-89810628 CTGTGAGACAAGGAACAGCAGGG - Intronic
1017074698 6:150606933-150606955 CTGTCAGACAGGGTGCAGGAAGG - Intronic
1017096558 6:150810273-150810295 CTGGGTGACAGGGTCCAGACAGG + Intronic
1019446264 7:1073189-1073211 CTGTGTGTGAAGCTGCAGAGTGG - Intronic
1020316600 7:6909810-6909832 CTATGTGACAGAGTGAAGAAAGG - Intergenic
1030710382 7:112742133-112742155 GTCTCTGACAAGGTGCAAAAAGG + Intergenic
1030896448 7:115066345-115066367 CTGTGTGTGAAGGGGCAGCATGG + Intergenic
1033076535 7:138255031-138255053 CTATGTGACCTGTTGCAGAAAGG + Intergenic
1034958198 7:155349019-155349041 CTGTCTGACCTGGTGGAGAATGG + Intergenic
1035344510 7:158189263-158189285 CTGTGGGACAAGGCGCAGCATGG - Intronic
1035977699 8:4331267-4331289 CGGTGACACAAGGTGCTGAATGG + Intronic
1038772987 8:30501286-30501308 CTCTGTAACAGGATGCAGAAAGG - Intronic
1046899433 8:119508151-119508173 CTGTGTAACAAGGGGTAGGAAGG + Intergenic
1047024207 8:120809702-120809724 TTGTGTGACAAGGGGCAGGTGGG - Intronic
1048419156 8:134260327-134260349 CAGAGTGAGAAGGTGCAGCATGG - Intergenic
1050062719 9:1727283-1727305 CTGGGTAACAGGGTGCACAATGG + Intergenic
1052561301 9:30087985-30088007 CCGTGTGACCAGTTGCAGAAAGG - Intergenic
1055750994 9:79504711-79504733 CCGAATGACATGGTGCAGAAAGG + Intergenic
1057887306 9:98839745-98839767 GGGTGTGACCAGGTGCACAAGGG - Intronic
1062005044 9:134234828-134234850 GTGTATGCCAAGGTGCAGAGGGG - Intergenic
1062227687 9:135462609-135462631 CTGAGGGCCAGGGTGCAGAAAGG + Intergenic
1062530239 9:136996500-136996522 CTGTTTGTCAAGGTGCAGGGCGG - Exonic
1190620653 X:52284354-52284376 CAGGATGACAAGCTGCAGAAAGG - Intergenic
1196441975 X:115726848-115726870 GTGTGAGACATGGTGCAGATAGG + Intergenic
1196442636 X:115729810-115729832 GTGTGAGACATGGTGCAGATAGG + Intergenic
1196442922 X:115731095-115731117 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196443587 X:115734063-115734085 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196445913 X:115845990-115846012 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196446584 X:115848971-115848993 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196447252 X:115851952-115851974 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196447923 X:115854927-115854949 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196448592 X:115857914-115857936 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196449263 X:115860905-115860927 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196449932 X:115863892-115863914 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196450602 X:115866867-115866889 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196451273 X:115869856-115869878 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196451944 X:115872839-115872861 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196452614 X:115875818-115875840 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196453284 X:115878787-115878809 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196453954 X:115881796-115881818 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196454620 X:115884801-115884823 GTGTGAGACATGGTGCAGATAGG - Intergenic
1196455033 X:115886891-115886913 GTGTGAGACATGGTGCAGATAGG - Intergenic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1198722856 X:139642732-139642754 CTGAATTACAAGGAGCAGAAGGG - Intronic
1201329855 Y:12805946-12805968 CTGTGTGAAAAGGCACAGACTGG - Intronic
1201339713 Y:12921392-12921414 CTGTGAGACCAAGTGCAAAACGG - Intergenic
1201701009 Y:16882352-16882374 CTGTGTAACATGGTGGAGTAGGG - Intergenic
1201771410 Y:17620412-17620434 CTGTGTGGCAAGGATCAGGAAGG + Intergenic
1201830145 Y:18285574-18285596 CTGTGTGGCAAGGATCAGGAAGG - Intergenic