ID: 1083905241

View in Genome Browser
Species Human (GRCh38)
Location 11:65664831-65664853
Sequence ACAGAATTCTGGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083905241_1083905245 30 Left 1083905241 11:65664831-65664853 CCACACCTGGCCCAGAATTCTGT No data
Right 1083905245 11:65664884-65664906 TGCCTACACAATATATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083905241 Original CRISPR ACAGAATTCTGGGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr