ID: 1083909886

View in Genome Browser
Species Human (GRCh38)
Location 11:65700480-65700502
Sequence GGTGAGTTAATGCAAATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 2, 1: 9, 2: 21, 3: 33, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083909886 Original CRISPR GGTGAGTTAATGCAAATTGA TGG Intergenic
902259939 1:15217318-15217340 AGTGGGTTAATGTAAATTGAAGG - Intronic
902260116 1:15218833-15218855 GGTGGGTTAATGCAAATTGAGGG - Intronic
905611814 1:39359201-39359223 CGTGACATAATGGAAATTGAAGG + Exonic
905764938 1:40592498-40592520 GGTGGGTTAATGCAAATTGAGGG - Intergenic
906360111 1:45148897-45148919 GGTGTGTTGATACAAATTGAAGG - Intronic
907412768 1:54294266-54294288 GGTAAGTTAATGGAAGGTGATGG - Intronic
909051987 1:70777196-70777218 GGCAGGTTAATGCAAATTGAGGG - Intergenic
910835741 1:91507684-91507706 TGTGAGTTATAGCAACTTGATGG + Intronic
910899360 1:92103108-92103130 TGTGAGTTATTGCAAATTGATGG + Intronic
910899364 1:92103164-92103186 TGTGAGTTATTGCAAATTGATGG + Intronic
916248284 1:162709923-162709945 GGAGAGAAAATGCAAACTGAAGG - Intronic
917614336 1:176724085-176724107 GCTTAGTGAATGCTAATTGAAGG - Intronic
918682433 1:187372058-187372080 AGTGGGTTAATGCAAACTAAAGG - Intergenic
918925403 1:190779356-190779378 TTTGAGTTAATGAAAAATGAAGG + Intergenic
921802406 1:219416616-219416638 GGTTGATCAATGCAAATTGAGGG + Intergenic
922968606 1:229715314-229715336 GACAGGTTAATGCAAATTGAGGG - Intergenic
923202459 1:231725491-231725513 GGTGAGCTAGTGCAAATTGAGGG - Intronic
923995897 1:239494091-239494113 GGCAGGTTAATTCAAATTGAGGG + Intronic
924229351 1:241950298-241950320 TGGGAGTTAATGCCAATTGAAGG - Intergenic
924240298 1:242033664-242033686 GGTGATTTACTGAAAACTGAAGG + Intergenic
924273049 1:242354305-242354327 GGTGGATCAATGCAAATTCAGGG - Intronic
1063221935 10:3976903-3976925 GGTGACTTCATGCAAACTTATGG + Intergenic
1063925784 10:10975947-10975969 GGTGGGTCAATGGAAATTGAGGG + Intergenic
1064461714 10:15541013-15541035 GGTGGGTGAATGCAAATTGAAGG - Intronic
1064710902 10:18123420-18123442 AGTGGGTTAATGCAAATGGAGGG - Intergenic
1065386605 10:25140036-25140058 TGTGAATTACTGCAAACTGAGGG + Intergenic
1066711663 10:38242354-38242376 GGTGGATCAATGCAAATTCAGGG + Intergenic
1067960109 10:50838698-50838720 GGTGGATAAAAGCAAATTGAAGG + Intronic
1068657272 10:59588586-59588608 GGCAGGTTAATGCAAACTGAAGG + Intergenic
1070326413 10:75392408-75392430 GCTGAGGGAATGCAAAGTGAGGG + Intergenic
1071740140 10:88348749-88348771 GGTGAGGAAATGAAAAATGAGGG - Intronic
1071985665 10:91047563-91047585 GGTGAGGTAATGAACATTGCTGG + Intergenic
1074802465 10:117014930-117014952 TTTGAGTTACTGCAAAGTGATGG + Intronic
1075787822 10:125061861-125061883 AGTGAATTCATGCAAAGTGACGG - Intronic
1075966999 10:126621810-126621832 GATGAGTTAAAGCAAAGTCAGGG - Intronic
1076200559 10:128554442-128554464 GGTGGGTTAATGTAAACTGAGGG + Intergenic
1076330323 10:129659586-129659608 GATGAGTTAGTGCAAATTGAGGG + Intronic
1077983113 11:7321763-7321785 GGCGGGTTAATGCAAATAGAGGG + Intronic
1078978998 11:16510367-16510389 GCTGAATTAATACAAGTTGAAGG - Intronic
1079281867 11:19094870-19094892 GGTGAGATAATAAAAATTCAAGG - Intergenic
1080933608 11:36838929-36838951 GGTGAGTGAATGGAACATGAAGG + Intergenic
1080940061 11:36906245-36906267 GGTGAGTTTATGCAGGTTTAAGG + Intergenic
1083700333 11:64473224-64473246 GGTGGTTCAATGTAAATTGAAGG - Intergenic
1083909886 11:65700480-65700502 GGTGAGTTAATGCAAATTGATGG + Intergenic
1083915722 11:65742396-65742418 CGTGAGTCAATTCAAATTGAGGG + Intergenic
1088380197 11:109184369-109184391 GGTGGGTCAATGGAAATTGATGG + Intergenic
1089625461 11:119748273-119748295 GGTGCTTTAGTGCAACTTGAAGG + Intergenic
1090681911 11:129068849-129068871 GATGAGATACTGCAAATTGAGGG - Intronic
1091834349 12:3575081-3575103 GGTGATTTAATGGGATTTGATGG + Intronic
1094475960 12:30840745-30840767 GATGGGTCAATGCAAATTGAGGG + Intergenic
1094794596 12:33956542-33956564 GGCTAGTTACTGCAGATTGAGGG - Intergenic
1097375973 12:58843079-58843101 GCTAAGTGAGTGCAAATTGATGG + Intergenic
1099027943 12:77489621-77489643 GGTGAGTGAATATAAATTCAAGG + Intergenic
1099147954 12:79071540-79071562 GTTGAGGTTATGCAAATTGGTGG - Intronic
1099839133 12:87943973-87943995 GGCAAGCTAATGCAAATTGATGG + Intergenic
1100723497 12:97384360-97384382 GGTGATTTTTTACAAATTGAAGG - Intergenic
1103879007 12:124151694-124151716 GGCAGGTTAATGCAAATTGAGGG + Intronic
1104195615 12:126534536-126534558 GAGTGGTTAATGCAAATTGAAGG + Intergenic
1105065208 12:133191345-133191367 ACTGATTTAATGCACATTGATGG + Intronic
1105796263 13:23856510-23856532 GGTGGGTTAATGCAAATTGGGGG + Intronic
1106716714 13:32397044-32397066 GGTAAGTTAATGTAAACTCAAGG + Exonic
1107762479 13:43695341-43695363 GGTCAGTTAAAGCACTTTGATGG - Intronic
1108048450 13:46405722-46405744 GGTGGGCTAATGCAAATTTAGGG - Intronic
1108376819 13:49821748-49821770 GGAGGGTTAATGCAAATTGAGGG - Intergenic
1109256964 13:60095431-60095453 GGTGGGTCAATGTAAATTAAGGG + Intronic
1109740275 13:66544653-66544675 AGTGGTTTAATGTAAATTGAAGG + Intronic
1110139657 13:72112875-72112897 GGTAAGTTATTACAATTTGATGG + Intergenic
1110497054 13:76180349-76180371 GGCAGATTAATGCAAATTGAGGG - Intergenic
1111179600 13:84645782-84645804 GGTGGATCAATGCAAATTGAGGG + Intergenic
1112023870 13:95394861-95394883 GTTCAGTTAATGAAAATCGAGGG + Intergenic
1112392207 13:98995838-98995860 GCTGAGTTAGTGCAAATTGAGGG + Intronic
1112583575 13:100697168-100697190 AGTGGGTTAATGCAAATTTGGGG + Intergenic
1112751486 13:102588330-102588352 GGTGGGTTAATGCAAACTGAGGG + Intergenic
1116259351 14:42602983-42603005 GGCAGGTTAATGCAAATTGAGGG + Intergenic
1116640457 14:47455668-47455690 TATGAGTGAATGTAAATTGAAGG + Intronic
1118046737 14:61978285-61978307 GGAGAGTTGATGAAAATTGGAGG + Intergenic
1119803347 14:77464828-77464850 GGTGAATGAATGCATATTGCAGG - Intronic
1125379493 15:39072411-39072433 GGTGAGTGAATGCAGACTAAGGG + Intergenic
1125840009 15:42791429-42791451 GAGAAGGTAATGCAAATTGAAGG - Intronic
1126879075 15:53075282-53075304 AGGCAGTTAATGAAAATTGAGGG - Intergenic
1128320444 15:66690048-66690070 GGTGAGATAATTCCAAATGAGGG - Intergenic
1133475236 16:6114969-6114991 GACAAGTTAATGCAAACTGAGGG + Intronic
1134589440 16:15440461-15440483 GCTGAAATAATGCAAATTGCTGG + Intronic
1135065206 16:19303912-19303934 GGTGACTTAATGAAAAATGGAGG + Intronic
1135527623 16:23226241-23226263 GGACAGTTTATGGAAATTGATGG + Intergenic
1138777435 16:59740915-59740937 GGAAGGTTAATGCAAATTGAGGG + Intronic
1140300584 16:73753475-73753497 AGTGGGTTAAAGTAAATTGAGGG - Intergenic
1140614157 16:76639977-76639999 GGTGAGTCAATGCAAATTGATGG + Intergenic
1142335059 16:89483127-89483149 GATGAGTGAAGGCAAATGGAGGG - Intronic
1144303057 17:13941311-13941333 GGTGAGTCAATGCAAATTGAGGG + Intergenic
1146087972 17:29847875-29847897 GGCAGGTTAATGCAAATTGAGGG - Intronic
1150968290 17:69997031-69997053 GGAGAGTTACTGCAATGTGATGG + Intergenic
1151905464 17:77045610-77045632 GGTTGGTTAATGCAGAGTGAGGG - Intergenic
1152532674 17:80929119-80929141 GGAGAGTTAATTTAAAATGATGG + Intronic
1153039797 18:801563-801585 GGTGAGTTAGTAGAAATAGATGG - Intronic
1155523942 18:26697562-26697584 GGTGGGTCAATGCAATTTGAGGG + Intergenic
1159246991 18:65819231-65819253 AGTGGGTCAATGCAGATTGAGGG - Intronic
1159337061 18:67081955-67081977 GGTGAGCCAATGCAAATTGAGGG - Intergenic
1159337071 18:67082028-67082050 GGTGAGCCAATGCAAATTGAGGG - Intergenic
1162190758 19:8944675-8944697 AGTGAATTAATGAAAATAGAGGG - Intronic
925492878 2:4414536-4414558 GGTAAGAGAATGCAAATTGTTGG + Intergenic
926026990 2:9554344-9554366 GGTAAGTCAGTACAAATTGAAGG - Intronic
927024168 2:19048678-19048700 GGAGAGGTAATGTAAATTAAAGG - Intergenic
928404686 2:31005576-31005598 GGTGACTGAATGCTAATGGAGGG + Intronic
929419850 2:41779383-41779405 GGTGAATTCATGCAAATGTATGG + Intergenic
929432135 2:41896145-41896167 GGTGAGTTAATACAAGTATAGGG + Intergenic
930863708 2:56102496-56102518 GGTGGGCCAATGCAAATTGAGGG - Intergenic
931202948 2:60118081-60118103 GATAAGTTACTGCAAATTGAGGG + Intergenic
931965432 2:67528670-67528692 TGCAGGTTAATGCAAATTGAGGG - Intergenic
933486887 2:82935444-82935466 GGTGGGTCAATGCAAATTGAGGG - Intergenic
935011305 2:99138872-99138894 CATGAGTTAATGTTAATTGATGG + Intronic
935014400 2:99166452-99166474 AGTGAGTTAAAGCAAATAGGTGG + Intronic
937460767 2:122083780-122083802 GGTGAGTAGATGAAAATGGACGG - Intergenic
940540159 2:155004448-155004470 TGTGAGAAAAAGCAAATTGAGGG + Intergenic
942240271 2:173956948-173956970 GGTGTATTAATACAATTTGAGGG + Intronic
942529135 2:176889495-176889517 GGAGAGCTAATGGAAATGGAGGG + Intergenic
943324489 2:186481552-186481574 GGTGACTTTAGGCAAATTGTTGG - Intergenic
944173903 2:196808295-196808317 GATGGGTTAATGCAAACAGAAGG + Intronic
944846335 2:203671851-203671873 GGTGATTTCATTCCAATTGATGG + Intergenic
945036622 2:205709039-205709061 GGTGAGTTAATGCATATCAATGG - Intronic
945672666 2:212820803-212820825 ATTAAGTTAATGCAAATTCAAGG - Intergenic
945711880 2:213307112-213307134 GGTGAGTTGAGGCAAATTTTGGG - Intronic
945914123 2:215684561-215684583 GATGAGTTAATGGAAACTCAGGG + Intergenic
947915269 2:233828536-233828558 GGAGAGGTAATGCAGATTGGTGG - Intronic
1169035414 20:2447150-2447172 GGCAGGTTGATGCAAATTGAGGG - Intergenic
1169595176 20:7190293-7190315 GGTGAGTTAGTTAAAATTGAAGG + Intergenic
1173800938 20:45894084-45894106 GGAGAGCTCATGCAAAGTGATGG - Intronic
1173891977 20:46519781-46519803 AGTGGATCAATGCAAATTGAGGG - Intergenic
1174260663 20:49292587-49292609 GGTGAGTTCATGTACCTTGAAGG + Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1175215058 20:57387960-57387982 GGTGAGAAAATGGAAATTGCAGG - Intergenic
1177355760 21:20004701-20004723 GATGAGTCAATGCAAATTGAGGG - Intergenic
1177387365 21:20425503-20425525 GGTGAGGTCCTGCAATTTGAGGG + Intergenic
1178026795 21:28477634-28477656 GGTGAGGTAATGCAAATTGAGGG - Intergenic
1178042339 21:28653002-28653024 GGAGGGTTAATGCAAATTGAGGG - Intergenic
1185242914 22:49755980-49756002 GATGGGCCAATGCAAATTGAGGG - Intergenic
950330114 3:12149435-12149457 TGACAGTTAAAGCAAATTGAAGG + Intronic
950779380 3:15378223-15378245 GGCAAGCTGATGCAAATTGAGGG + Intergenic
951114660 3:18845868-18845890 TGTGAGTTAATGAAAACTCAGGG - Intergenic
951641654 3:24843412-24843434 GGTGAGAAAATGTAAATTCAGGG - Intergenic
957854151 3:85851875-85851897 GGTGAGTTAATGAAGAATGAAGG + Intronic
958796816 3:98714797-98714819 GATGAGTTAATACAGTTTGATGG - Intergenic
959770637 3:110090912-110090934 GGCAAGTCAATGCAAATTGAGGG + Intergenic
960839231 3:121939495-121939517 GGTAAGTTTTTGCAAATAGAAGG + Exonic
962008186 3:131369120-131369142 GTTGAGTGAATGGAAAATGAGGG + Intergenic
962682144 3:137811340-137811362 GCTGAGTTACTTCAAGTTGAAGG + Intergenic
964111415 3:153091565-153091587 AGTGAGTTAATGCAAAACAAGGG - Intergenic
964562716 3:158015721-158015743 GCTGAGCTAATGCTAACTGAAGG - Intergenic
971468615 4:26993701-26993723 GATGAGTTTATGCAAAGGGAAGG - Intronic
971786290 4:31107237-31107259 GGTGAAATAATGCAAATTGAAGG + Intronic
974262912 4:59547544-59547566 AGTGAGAAAATGAAAATTGAAGG - Intergenic
974845051 4:67341936-67341958 GTTGAGTTAATGAAAACTCAGGG + Intergenic
975318140 4:72978748-72978770 TCTGAGTCAATACAAATTGAGGG - Intergenic
976313961 4:83639499-83639521 GGTGAGCTCATGAAAATGGAAGG - Intergenic
978850663 4:113332076-113332098 AGTGACTTAAAACAAATTGATGG + Intronic
985009204 4:185565330-185565352 TGTAAATTCATGCAAATTGATGG + Intergenic
985102545 4:186473173-186473195 GGTGAGTTAATGCAGTTACATGG + Intronic
986209494 5:5657344-5657366 GTGGGGTTATTGCAAATTGAGGG - Intergenic
987145749 5:14989792-14989814 GGGAAATTAATGGAAATTGAAGG + Intergenic
988095575 5:26605238-26605260 GGTGAGTAAATACAAATGGAGGG - Intergenic
988150149 5:27366442-27366464 GGTTAGTTAATGCTAATGTATGG - Intergenic
993564620 5:89457925-89457947 GGTGTGATGATGCAAATAGAAGG + Intergenic
993747357 5:91617449-91617471 GGTGAGATAAAGATAATTGAAGG - Intergenic
996602997 5:125288667-125288689 GTGGAATTAATGCAAATAGAGGG - Intergenic
996644271 5:125795553-125795575 AGTGGGTTAATTCAGATTGAAGG - Intergenic
997065445 5:130554185-130554207 GGTGGGTCAATGCAAATTGAGGG - Intergenic
997418835 5:133750308-133750330 GGTGAATTAAAGCAAAATGTTGG + Intergenic
999547687 5:152648653-152648675 AGTGAGTTAAAGAAAATTGGAGG + Intergenic
1003043807 6:2714335-2714357 GGTGAGTTAATGCAAATTGAGGG - Intronic
1004302922 6:14474856-14474878 GGGGAGTTGATGAAAATAGAGGG + Intergenic
1005042710 6:21613685-21613707 GGGTAGTTAATCCAAATTGCAGG - Intergenic
1009370477 6:62894377-62894399 TGTGGATTAATGCAAATTGAGGG + Intergenic
1010675912 6:78742751-78742773 GGTGGGTTAATGCAAATTGAGGG - Intergenic
1010865953 6:80976977-80976999 GGCAGGTCAATGCAAATTGAGGG - Intergenic
1010866605 6:80983336-80983358 GGAAGGTCAATGCAAATTGAGGG - Intergenic
1011344285 6:86352097-86352119 GTTGAGTTAATGGACATGGAGGG - Intergenic
1013072220 6:106739644-106739666 GCTGAGTCAATGCCAATGGAAGG + Intergenic
1013323679 6:109022255-109022277 GGTAAATGAATGCCAATTGATGG + Intronic
1014995951 6:128144583-128144605 GGTGAGGGAATGGAAAATGATGG - Intronic
1016519576 6:144931465-144931487 GGCAGGTCAATGCAAATTGAGGG + Intergenic
1017327848 6:153160083-153160105 GTTGAGCTAATGCAAATGGCTGG - Intergenic
1019549946 7:1597139-1597161 GATGAGTTATTGCAAACTGTGGG + Intergenic
1024747670 7:52427160-52427182 GGTGGGTTAATGCAAATTGAGGG - Intergenic
1026504822 7:70973586-70973608 GGGGAGTTAGTGAAAATTCAGGG - Intergenic
1027462784 7:78476314-78476336 GGTTAGTTAAACCAAAGTGAAGG + Intronic
1027543806 7:79501241-79501263 GGTGAGCTATTGCAAAATTATGG + Intergenic
1029817934 7:103115836-103115858 AATGGGTTAATGCAAATTAAAGG + Intronic
1030695062 7:112576194-112576216 CCTGAGTTAAAGCAAAGTGATGG + Intergenic
1030776764 7:113543306-113543328 GACGAGTCAATGCAAATTGAGGG - Intergenic
1032381258 7:131484287-131484309 TGTGAGTTAATAAAAATTAAAGG + Intronic
1034981099 7:155477310-155477332 AGTGCGTTTTTGCAAATTGAAGG + Intronic
1039393879 8:37206241-37206263 GGTTAGTTATTGCAGTTTGAAGG + Intergenic
1039725037 8:40206393-40206415 GGCAGGTTAATGCAAATTGCAGG + Intergenic
1046661286 8:116950306-116950328 GATCAGTTAATGCATACTGAAGG + Intronic
1047540623 8:125762161-125762183 GATGAATGAATGCAAAATGATGG - Intergenic
1047885422 8:129245103-129245125 GGTGATTAAAAGCAAATTGGAGG + Intergenic
1050266318 9:3893854-3893876 GGTGATTTGATGCATACTGAAGG + Intronic
1051011161 9:12416232-12416254 GGCGAGTCAAAGCAAATTAAGGG + Intergenic
1055079495 9:72255227-72255249 GGTGGGTGGATGCAAATTGAGGG + Intronic
1056261980 9:84858077-84858099 GGTGACTGATTGCAAATTGAGGG - Intronic
1056339972 9:85618743-85618765 GTTGATTTCATCCAAATTGAAGG - Intronic
1056618664 9:88191446-88191468 GGTGAATTAATGCAAATTAAGGG + Intergenic
1058423796 9:104858906-104858928 ACTGAGTTAATGCAACTTGCAGG - Intronic
1060000769 9:119956837-119956859 AGTGAGTTAATGTAATTGGAAGG + Intergenic
1190364637 X:49680109-49680131 GGTCAGTCAATGCAAATTGAGGG + Intergenic
1190554768 X:51623082-51623104 GGCAGGTCAATGCAAATTGAGGG + Intergenic
1190628398 X:52359929-52359951 GGCGGGTTAATGCAAATTTAGGG - Intergenic
1190682074 X:52834999-52835021 GGTAGGTTAATGCAAATTGAAGG + Intergenic
1190953318 X:55167454-55167476 GGCAGGTTAATGCAAGTTGAGGG - Intronic
1190998999 X:55639145-55639167 GGTGGGTTAATGCAAATTGAAGG + Intergenic
1192551887 X:72061106-72061128 GGTGTGTTTATGAAAATGGAAGG + Intergenic
1195268835 X:103211340-103211362 AGTGGGTTAATGCAAATTGAAGG - Intergenic
1195373932 X:104207066-104207088 GGTGGGTTAATGCAAATTGAGGG + Intergenic
1195389222 X:104343690-104343712 GGCAGGTTAATGCAAATTGAGGG + Intergenic
1197613638 X:128666888-128666910 GGTTATTGTATGCAAATTGAGGG - Intergenic
1198049951 X:132941600-132941622 GGTGACTTAATGCCAATTAGAGG - Intronic
1198212236 X:134527098-134527120 GGAGGGTGAATGCAAAATGAGGG - Intergenic
1198846586 X:140918743-140918765 GGTGGGTTAATGCAAAATGAAGG - Intergenic