ID: 1083910401 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:65705301-65705323 |
| Sequence | CAATCAAGGCAGAGGGTGAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1083910401_1083910406 | -9 | Left | 1083910401 | 11:65705301-65705323 | CCCTTCACCCTCTGCCTTGATTG | No data | ||
| Right | 1083910406 | 11:65705315-65705337 | CCTTGATTGTAAGTTTCCTGAGG | 0: 63 1: 5883 2: 8514 3: 6848 4: 4518 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1083910401 | Original CRISPR | CAATCAAGGCAGAGGGTGAA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||