ID: 1083910401

View in Genome Browser
Species Human (GRCh38)
Location 11:65705301-65705323
Sequence CAATCAAGGCAGAGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083910401_1083910406 -9 Left 1083910401 11:65705301-65705323 CCCTTCACCCTCTGCCTTGATTG No data
Right 1083910406 11:65705315-65705337 CCTTGATTGTAAGTTTCCTGAGG 0: 63
1: 5883
2: 8514
3: 6848
4: 4518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083910401 Original CRISPR CAATCAAGGCAGAGGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr