ID: 1083912106

View in Genome Browser
Species Human (GRCh38)
Location 11:65716072-65716094
Sequence GTGTGCAGAAGTAAAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083912104_1083912106 6 Left 1083912104 11:65716043-65716065 CCCACAATGTCTGAAATGCAGGA 0: 1
1: 0
2: 1
3: 22
4: 198
Right 1083912106 11:65716072-65716094 GTGTGCAGAAGTAAAGCAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 213
1083912105_1083912106 5 Left 1083912105 11:65716044-65716066 CCACAATGTCTGAAATGCAGGAG 0: 1
1: 0
2: 2
3: 29
4: 187
Right 1083912106 11:65716072-65716094 GTGTGCAGAAGTAAAGCAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083912106 Original CRISPR GTGTGCAGAAGTAAAGCAGC AGG Intronic
900669089 1:3838699-3838721 GGATGCAGCAGAAAAGCAGCAGG + Intronic
901017915 1:6242320-6242342 CTGTGCAGATGTGCAGCAGCTGG + Intergenic
903809890 1:26029387-26029409 GAGTCCAGGAGTAAAGGAGCAGG - Intronic
910291404 1:85603439-85603461 GTGTTAAGAAGTAAAACAGGTGG - Intergenic
911100150 1:94089032-94089054 GCCTGCAGAAGTAAAGGAGAGGG - Intronic
911621843 1:100074181-100074203 ATGTGCAGAATTACTGCAGCAGG - Intronic
911668114 1:100577417-100577439 TTGTGCAGAAGTCAGGGAGCTGG - Intergenic
915209936 1:154300962-154300984 TTGTGAAGAAGTAAAGTGGCTGG - Intergenic
915607447 1:156961742-156961764 GTGTGCAGAAGTTTATCAGCAGG - Exonic
916520395 1:165558184-165558206 GTGTACAGAAATAAACCAGGTGG + Intronic
916841962 1:168609916-168609938 GGGTGCGGTATTAAAGCAGCAGG + Intergenic
917856808 1:179107903-179107925 CTGAGCAGTAGTCAAGCAGCTGG + Exonic
918114594 1:181485229-181485251 GTGTGCAGCAGTGAGGCAGCTGG + Intronic
918651363 1:186967430-186967452 GTGTGCACAAAGAAGGCAGCTGG - Intronic
919644383 1:200079379-200079401 GAGTGTAAATGTAAAGCAGCGGG - Intronic
919868907 1:201805454-201805476 CTGTGCAGAAGAGAAGCAGAGGG + Intronic
920193525 1:204211138-204211160 GGGTGCAGGAATAAAGCAGGAGG - Intronic
921770847 1:219038288-219038310 ATGTGGAGAACTAAAGCAGAGGG + Intergenic
923500383 1:234559481-234559503 GTGTGCAGAGGGAGAGCAACTGG - Intergenic
923822444 1:237460070-237460092 GAGTGGAGACATAAAGCAGCTGG - Intronic
1064084912 10:12338209-12338231 GTGAGCAGGGGAAAAGCAGCTGG + Intergenic
1069088254 10:64167597-64167619 ATGTCCAGAAGTAGAGCTGCTGG + Intergenic
1069863649 10:71486809-71486831 GTGTGCAGGAGTGAGGGAGCAGG + Intronic
1070406846 10:76104851-76104873 GAGTGCAGGAGAAAGGCAGCAGG - Intronic
1071672188 10:87618989-87619011 GTGTACAGAGGCACAGCAGCCGG - Intergenic
1071752511 10:88496424-88496446 GTCTGAAGAAGTAAAGCGTCAGG - Intronic
1071931952 10:90482320-90482342 GTGGGAAGAAGTAAGGCAGCAGG + Intergenic
1075895281 10:125989802-125989824 GTGTGCTGAAGGAAGGCAGAGGG + Intronic
1077684164 11:4275228-4275250 GGGTGCAGAGGGAAAGCATCAGG + Intergenic
1077685879 11:4291537-4291559 GGGTGCAGAGGGAAAGCATCAGG - Intergenic
1077691028 11:4342697-4342719 GGGTGCAGAGGGAAAGCATCAGG - Intergenic
1080976183 11:37343404-37343426 GTGTGCAAAGGGAAAGCAGCAGG + Intergenic
1081457954 11:43243881-43243903 GTGGGGAGAGGTGAAGCAGCTGG - Intergenic
1082177114 11:49073398-49073420 TTGTTCTGAAGAAAAGCAGCAGG + Intergenic
1083484233 11:62973262-62973284 GCCTGCAGAAGAAACGCAGCTGG - Intronic
1083912106 11:65716072-65716094 GTGTGCAGAAGTAAAGCAGCAGG + Intronic
1089778814 11:120858535-120858557 GAGTCCAGCAGTGAAGCAGCTGG - Intronic
1091260764 11:134232375-134232397 GTTTGCAGAAGTATTGCAGATGG + Intronic
1091841684 12:3625850-3625872 CTTTGCAGAAGTTAAGCACCAGG - Intronic
1093256883 12:16879484-16879506 ATGTACAAAAGAAAAGCAGCTGG - Intergenic
1095246391 12:39928649-39928671 GTGTGAGGAAATAAAGCTGCTGG - Intronic
1096084796 12:48858217-48858239 TTGTGCAATAGCAAAGCAGCTGG - Exonic
1097565640 12:61265334-61265356 GTGTGCAGAAGTCAAGAATTGGG + Intergenic
1098928246 12:76377757-76377779 GAGTGCAGAGGTAAACCACCTGG + Intronic
1102822491 12:115919970-115919992 GTGTGCAGAAATCAAGTTGCAGG + Intergenic
1103526233 12:121570555-121570577 GTGTGGAGGATGAAAGCAGCCGG - Intronic
1104387940 12:128366932-128366954 GTGTGCAGAAGTAAGTCACATGG + Intronic
1105658207 13:22463614-22463636 GTATGCTGAAGTAAAGCACTTGG - Intergenic
1108941794 13:55964256-55964278 TTGTGTAGAAGAAAAGCTGCTGG - Intergenic
1111017063 13:82394820-82394842 GAGTGAAGAAGTGAAGCAGCTGG + Intergenic
1111546302 13:89741317-89741339 GTGTGCAGAAGGAGCCCAGCGGG + Intergenic
1111857016 13:93651121-93651143 GTTTGGATAAATAAAGCAGCAGG + Intronic
1112552496 13:100434686-100434708 TTGTGCAGGAGAAAAGCAGGCGG - Intronic
1112645477 13:101326844-101326866 TTGTTCAGAAGTCAAGCAGCTGG + Intronic
1113074199 13:106451964-106451986 GAGTGCAGAAGGAAAAGAGCAGG + Intergenic
1113630762 13:111882052-111882074 GTGAGCAGCAGCAAAGAAGCAGG + Intergenic
1116892025 14:50277831-50277853 GGTGGCAGAAGTAAATCAGCAGG + Intronic
1119872417 14:78028927-78028949 CTGTGCAGAAGTATAGCTGGAGG + Intergenic
1120045676 14:79802892-79802914 GTGTGGAGAAGGAGAGCATCAGG + Intronic
1120218790 14:81709591-81709613 TTGGACAGAAATAAAGCAGCTGG - Intergenic
1121400609 14:93673863-93673885 GTGAGCAGAAGTAAAGGAGAGGG + Intronic
1122939498 14:104974900-104974922 GTGTGGAGAAGTATAGGTGCTGG - Intronic
1125134768 15:36328713-36328735 GTGTGAAGAAGTGAAGCCACTGG - Intergenic
1125866039 15:43050262-43050284 CTGTGCAGAAGCAAATCATCTGG - Intronic
1126255047 15:46615524-46615546 GTGTGCAGAAGTAACACTGGAGG - Intergenic
1126786003 15:52178496-52178518 GTGTGGAGAAGAAAGGCAGAAGG + Intronic
1126887383 15:53165306-53165328 CTGTGCAGGAGAAAAGCAGAGGG - Intergenic
1128197248 15:65770082-65770104 GTGAGCAGAAATAGAGCAGCAGG - Intronic
1129527993 15:76234743-76234765 GTGCGGAGAAGTAAAGCCACAGG + Intronic
1129784687 15:78301485-78301507 GTGTGCAGCAGAAGAGCTGCAGG - Intergenic
1131253617 15:90846878-90846900 ATGTGCCGAGGTAAAGCAGACGG - Intergenic
1133756187 16:8764326-8764348 GTGTGCAGGACAAAAGGAGCTGG + Intronic
1135064683 16:19299552-19299574 GTATGGAGAAGTAAAAGAGCTGG - Intronic
1135586036 16:23671768-23671790 GAGTGCACAAGGAAAGCAGGTGG - Exonic
1138641613 16:58392375-58392397 GTCTGCAGATTTAGAGCAGCGGG - Exonic
1140696661 16:77541352-77541374 TTGAGCAGACGTTAAGCAGCTGG - Intergenic
1143601525 17:7949206-7949228 GTGTGCAGAGGTGAAGGAGCTGG - Intronic
1144644566 17:16963384-16963406 CTGTGCAGGAGTGAAGGAGCAGG + Intronic
1144765324 17:17729404-17729426 GTGGGCAGAGGTATGGCAGCAGG - Intronic
1149331206 17:55584068-55584090 GTGGGTAGAAGCAAAGCACCAGG - Intergenic
1149739513 17:59031901-59031923 GGCTGCAGAAGTGAAGCAGGTGG + Exonic
1150751372 17:67865853-67865875 TTGTCCAGAAGTAAAGAAGAGGG + Intronic
1151134310 17:71931029-71931051 GTGAGCAGAAGCAAAGGAGAGGG + Intergenic
1152664737 17:81560842-81560864 GAGTGAAGATGTGAAGCAGCTGG - Intronic
1154253961 18:12767050-12767072 GAGGGCAGAAGTGAAGCAGGAGG + Intergenic
1156030744 18:32709208-32709230 TGTTGCAGAAGCAAAGCAGCCGG - Intronic
1157324854 18:46661476-46661498 GCCTGCAGAAGGAAAGCACCAGG - Intergenic
1158815361 18:61088657-61088679 GTGTGTAGACCTAAAGCATCAGG - Intergenic
1164514923 19:28926083-28926105 GTCTGCAGTAGTACACCAGCAGG + Intergenic
1164562929 19:29306153-29306175 GTGTTGGGAAGTGAAGCAGCTGG - Intergenic
1166597273 19:44060880-44060902 GTGCACAGAAGTAAAACAGATGG - Intronic
1166709801 19:44929405-44929427 CTGTGGGGAAGTAAAGCAGAAGG + Intergenic
1167575026 19:50313905-50313927 GTGTGCAGAGGTTAAGTCGCAGG + Intronic
925758903 2:7165134-7165156 GTGTGCAGAAGTAAGCCAATAGG + Intergenic
926072861 2:9914373-9914395 GTGGGCACAAGAATAGCAGCAGG + Intronic
926541209 2:14182982-14183004 GTGGGGAGAAGTCAGGCAGCAGG - Intergenic
927217637 2:20677350-20677372 GAATGCAGATGCAAAGCAGCTGG - Intergenic
927998888 2:27506247-27506269 GAGTGCAGCAGGAAAGCACCAGG - Intronic
928044903 2:27920392-27920414 GGATGCAGCAGTAAAGAAGCTGG - Intronic
928605809 2:32944622-32944644 TAATACAGAAGTAAAGCAGCAGG + Intergenic
928616050 2:33040618-33040640 GTGTGGAGCAGAAAAGGAGCAGG - Intronic
929728488 2:44459067-44459089 GTCTACAGAGGTAGAGCAGCTGG - Intronic
930182731 2:48380426-48380448 GTGCCCAGAAGTAAATCTGCTGG - Intergenic
930621321 2:53646830-53646852 GTGTGCAGCAGAAAAGTAGTTGG + Intronic
931164590 2:59733167-59733189 GTGTAGAGAAGTAAGGCATCCGG - Intergenic
931484000 2:62671822-62671844 ATTGGCAGAAGCAAAGCAGCAGG + Intergenic
931918148 2:66981861-66981883 GAGTCCAAAAGTAAAGCAGATGG + Intergenic
932102396 2:68912853-68912875 GGGTGCAGAAGAGAAGTAGCAGG + Intergenic
932825013 2:74930977-74930999 GTGTGCAGAAGCAGAGGTGCAGG + Intergenic
933966711 2:87435896-87435918 GAATGCAGAAGCAAAGCAGATGG - Intergenic
934582832 2:95459398-95459420 TTGTTCTGAAGAAAAGCAGCAGG - Intergenic
934596618 2:95617316-95617338 TTGTTCTGAAGAAAAGCAGCAGG + Intergenic
934786152 2:97008247-97008269 TTGTTCTGAAGAAAAGCAGCAGG - Intronic
935628229 2:105189156-105189178 ATTTGCAGAAGTAAAAAAGCAGG - Intergenic
936327084 2:111514591-111514613 GAATGCAGAAGCAAAGCAGATGG + Intergenic
936693566 2:114921858-114921880 GAGTGCATGAGCAAAGCAGCAGG + Intronic
937854065 2:126660152-126660174 GTGTGCAGAGCCACAGCAGCAGG - Intronic
939969491 2:148644365-148644387 GTGTGCAGAAGTCCGGGAGCGGG - Intergenic
945173266 2:207018294-207018316 GGGTGCAGAAGTAAGGGATCGGG - Intergenic
946447683 2:219753771-219753793 GTGTGAAGAAGGCACGCAGCAGG - Intergenic
947062448 2:226181871-226181893 GTGAGCAAAAAGAAAGCAGCAGG - Intergenic
947441426 2:230125181-230125203 GTATGCAGAAGTAGAGGCGCTGG + Intergenic
947516307 2:230807891-230807913 GTGTGAGGAAGTACAGCAGAAGG - Intronic
948058627 2:235027729-235027751 CGCTGCAGAAGGAAAGCAGCTGG - Intronic
1171145202 20:22775189-22775211 GTGTCCAGAAGACAAGCAGTAGG + Intergenic
1171182001 20:23097925-23097947 GTGGGCAGATGGAAAGCAGTGGG - Intergenic
1171195045 20:23190207-23190229 GTCTGAAGAAATAAAGCAGCAGG + Intergenic
1171222178 20:23408552-23408574 GTTTCCAGAAGTGAAGCATCAGG - Intronic
1172304601 20:33872084-33872106 GTGAGCAGAGGTACCGCAGCAGG + Intergenic
1172578281 20:36026407-36026429 GTGTGCAGAAAGAATCCAGCAGG - Intronic
1173629454 20:44500337-44500359 GGGTCCAGACGTAAAGCAGGAGG + Exonic
1174519534 20:51118901-51118923 ACGTGCAGAAGCACAGCAGCCGG - Intergenic
1174822604 20:53740193-53740215 GTGTGCAGGAGTAAAGCCACTGG + Intergenic
1174842633 20:53914691-53914713 GTGTGCAGAAGCTAAGCTCCAGG + Intergenic
1175143774 20:56880738-56880760 GTCTGCAGTTGTAACGCAGCTGG + Intergenic
1177101532 21:16902934-16902956 GACGGCAGAAGTAAAGCAGAAGG - Intergenic
1180725747 22:17945531-17945553 GTGTCCCCAAGTAAAACAGCAGG + Intronic
950117111 3:10458268-10458290 GTGAGCAGATGTTAAACAGCAGG - Intronic
950395267 3:12729158-12729180 ATGTGCAGAAGTAGAACTGCTGG + Intergenic
950395522 3:12731099-12731121 ATGTGCAGAAGTAGAACTGCTGG + Intergenic
950928762 3:16768650-16768672 GTAGGAAGAAGTAAAGTAGCTGG - Intergenic
951106810 3:18753705-18753727 GTGTTAAGCAGTAAAGCAGAAGG + Intergenic
954272635 3:49521728-49521750 GAGGGCATCAGTAAAGCAGCTGG + Intronic
954290614 3:49648046-49648068 GTGTGAAGGAGCAAAGCACCAGG + Intronic
956138664 3:66124183-66124205 GGCTACAGAAGTAAAGTAGCAGG + Intergenic
956945548 3:74218414-74218436 GGGTGCAGAAGTTAAAGAGCAGG + Intergenic
957702998 3:83742232-83742254 GTGTGCACACATGAAGCAGCAGG + Intergenic
958754523 3:98234726-98234748 GTGTGCAGAAGGAAAGAATTTGG + Intergenic
959868870 3:111303527-111303549 GTGTGCAGGATGAAAGCCGCAGG + Intronic
962263416 3:133928882-133928904 GTGTGCAAAGGTAAGGAAGCAGG - Exonic
965070135 3:163908568-163908590 GGGTGCAGAAATAAAGGATCCGG - Intergenic
965409119 3:168307381-168307403 GTGTGCAGCAGTAAAGGAGAGGG - Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969224724 4:5788035-5788057 GTGTTCAGAAATTAAGGAGCTGG - Intronic
969844728 4:9911388-9911410 GTGAGCAGAGGTAAAGCTGAAGG - Intronic
973078603 4:45962075-45962097 GTATGCAGAAGTAAAGAACTGGG - Intergenic
973994759 4:56446775-56446797 GTTTGCAGAAGAATAGCAACTGG + Exonic
978609380 4:110520667-110520689 TTCTGAAGAAGTAAAGCAGAAGG + Intronic
980447954 4:132936450-132936472 GTATGCAGAGGAAAAGGAGCTGG - Intergenic
982212882 4:153055134-153055156 GTGTGTAGAATTAAAACACCAGG + Intergenic
982624357 4:157747177-157747199 GAAGGCAGAAGTAAAGCAGCAGG - Intergenic
983646848 4:170000182-170000204 GTATGCAGAAGTGATGCACCAGG + Intronic
983945042 4:173576523-173576545 GTGGGGAGAAGTAAATCAACAGG + Intergenic
986120176 5:4827872-4827894 GATTGCAGAAGAAAAGCAGTGGG + Intergenic
986565039 5:9104660-9104682 ATGTGGAGAAGTAGAACAGCAGG + Intronic
986731575 5:10638417-10638439 GTGGGCAGGAGGAAAACAGCAGG - Intronic
987756870 5:22107856-22107878 CTGTGCATCACTAAAGCAGCAGG + Intronic
988589910 5:32539809-32539831 CTGTTCAGAAGTAAAGCAGTTGG + Intronic
991173260 5:63653685-63653707 GTGTGCAGAATCAAAGCACAAGG - Intergenic
991700093 5:69309490-69309512 GTGCACAGAAGTAAAGAATCGGG + Intronic
994741617 5:103626129-103626151 GTATGTAGATGTGAAGCAGCAGG + Intergenic
994924393 5:106095865-106095887 GTGGACAGAAGGAAAGCAGCGGG + Intergenic
995534410 5:113120805-113120827 CTGGGCTGAAGAAAAGCAGCTGG - Intronic
996222820 5:120953823-120953845 GTGTACAGAAGTCAAGAAACGGG + Intergenic
996265569 5:121535280-121535302 GTGTGCACTGGTGAAGCAGCAGG - Intergenic
998399379 5:141840499-141840521 GTAGGCACAAGTACAGCAGCAGG + Intergenic
999009181 5:148016090-148016112 GTTTGCAGAAGGAATGCAGATGG + Intergenic
999021952 5:148175867-148175889 GTTTGCAGAAGTTAGGCAACAGG - Intergenic
1002447982 5:179301830-179301852 GTGTGAAGAAGGAGTGCAGCCGG + Intronic
1002805740 6:572558-572580 GTTTCCAGAAGTTAGGCAGCTGG + Exonic
1003565920 6:7222043-7222065 GTGTGAAGAAGGAAAGGAACAGG + Intronic
1004590411 6:17046089-17046111 CTGTGCTGGAGCAAAGCAGCAGG - Intergenic
1005316254 6:24605452-24605474 GTGGGCAAAAGGCAAGCAGCAGG - Intronic
1007445536 6:41902755-41902777 ATGTGCCAAAGTACAGCAGCTGG - Intergenic
1007696936 6:43740059-43740081 GGGTGCAGTAGTACAGGAGCTGG - Intergenic
1011127007 6:84018819-84018841 GTGTGTTCAAGTCAAGCAGCAGG - Intergenic
1011352140 6:86434651-86434673 GTGTGCTGAAGTAGACCAGGTGG + Intergenic
1015157345 6:130111476-130111498 GTGTGCTGAAGTGAAGCTGTGGG + Intronic
1016119105 6:140326119-140326141 GAGTGAAGAAGCAAAGCTGCTGG - Intergenic
1018085880 6:160300683-160300705 GAGTGCAGGAGTAAAGCAACAGG - Intergenic
1019400788 7:852246-852268 ATGTGCAGAGGTGAGGCAGCTGG + Intronic
1021593586 7:22291125-22291147 GGGTGCAGAAATAATGAAGCTGG - Intronic
1021716396 7:23466756-23466778 GTTAGCAAAAGAAAAGCAGCAGG + Intronic
1021918293 7:25457149-25457171 GGGTGGAAAAGCAAAGCAGCGGG - Intergenic
1022154122 7:27642100-27642122 GTGTGAAGAAGGAAAGAAGGTGG - Intronic
1022747599 7:33188660-33188682 GAGTTCAGAGGTTAAGCAGCTGG + Intronic
1022952744 7:35354065-35354087 ATTTGCAAAAGGAAAGCAGCTGG + Intergenic
1023380825 7:39606607-39606629 GTGTGCACAAATATAGCAACTGG - Intronic
1023661977 7:42479305-42479327 GAGTGCAGAAGTAAATGAGTGGG + Intergenic
1028742654 7:94293580-94293602 GTGTGCAGGAATACAGCTGCAGG + Intergenic
1029211161 7:98909415-98909437 GTGCACAGAAGTGAAGCATCTGG - Intronic
1029250435 7:99232606-99232628 GTGGGCAGAAATAGAACAGCTGG - Intergenic
1029347369 7:99988146-99988168 GTGTGGAGATGTGGAGCAGCTGG - Intergenic
1031346043 7:120668289-120668311 GTGTCAAGATGTAAAGCAGTAGG + Intronic
1033357212 7:140609820-140609842 GGGTTCAGAAGTTAAGAAGCTGG + Intronic
1033368035 7:140685951-140685973 GTATGCAGAATTAGAGGAGCAGG - Intronic
1036016212 8:4787607-4787629 GTTTGCAGAAGAATAGCAACTGG + Intronic
1036981477 8:13474291-13474313 GTGTGCAGAAGTCAAGAATTGGG + Intronic
1037184031 8:16040089-16040111 GTGGGGAGAGGTAAAGAAGCGGG - Intergenic
1038307960 8:26421638-26421660 GTGTGAAGAGGTAAAACAACGGG + Intronic
1041386338 8:57308636-57308658 GTTTGCAGAAAGAAAGAAGCTGG + Intergenic
1042045150 8:64642753-64642775 ATATACAGAAGTAAAGCACCAGG + Intronic
1042125206 8:65531284-65531306 CTGTGCAGAAGCAAAGCGGGTGG - Intergenic
1042797465 8:72680247-72680269 GTGTGAAGAAATGAAGCAGATGG + Intronic
1042820918 8:72929281-72929303 GTGGGAGGAAGTAAAGCAGCCGG - Intronic
1052124259 9:24755927-24755949 GTGTGCAGAAGTCAAGAACTGGG + Intergenic
1055088563 9:72339040-72339062 ATGTGCAGAAGTAGAGGAACTGG + Intergenic
1056037998 9:82629561-82629583 GTGTGCTGAAGTATAAAAGCTGG - Intergenic
1056286284 9:85090903-85090925 GTTTGTAGAAGTAGAGGAGCAGG + Intergenic
1056550416 9:87648760-87648782 GACTGCAGAAGAAAAGGAGCCGG - Exonic
1060772175 9:126340187-126340209 CTGTTCAGAAATCAAGCAGCTGG + Intronic
1060930111 9:127484281-127484303 GTGTTTAGAAATAAAGAAGCAGG - Intronic
1186472601 X:9833071-9833093 TTGTGGAGAAGGAAAACAGCAGG + Intronic
1189148093 X:38675718-38675740 GTGTGCAGAACTACACCAACTGG + Exonic
1190539443 X:51461976-51461998 TTGTGCAGCAGAAAAGTAGCCGG - Intergenic
1191894942 X:65982417-65982439 CTGGGCAGAGGAAAAGCAGCTGG - Intergenic
1195903155 X:109819194-109819216 GGCTGCAGAATTAAACCAGCCGG - Intergenic
1196567857 X:117229904-117229926 GTGTGCAGAAGTCAAGAATTGGG - Intergenic
1196905758 X:120432540-120432562 AAGTGCAGAAGAAAAGCAGAAGG + Intronic
1197015039 X:121614208-121614230 CAGTTCAGAAGTAATGCAGCTGG - Intergenic
1197421202 X:126238219-126238241 GTGGGCAGAGGTCATGCAGCAGG - Intergenic