ID: 1083919649

View in Genome Browser
Species Human (GRCh38)
Location 11:65775433-65775455
Sequence TGTCCTTTGAAGGATATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083919641_1083919649 27 Left 1083919641 11:65775383-65775405 CCTTGCCACTGGAGTTCCGTGGA No data
Right 1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG No data
1083919642_1083919649 22 Left 1083919642 11:65775388-65775410 CCACTGGAGTTCCGTGGAAGAGA No data
Right 1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG No data
1083919639_1083919649 28 Left 1083919639 11:65775382-65775404 CCCTTGCCACTGGAGTTCCGTGG No data
Right 1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG No data
1083919644_1083919649 11 Left 1083919644 11:65775399-65775421 CCGTGGAAGAGAGAAATGGAGTC No data
Right 1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083919649 Original CRISPR TGTCCTTTGAAGGATATGGA TGG Intergenic
No off target data available for this crispr