ID: 1083919684

View in Genome Browser
Species Human (GRCh38)
Location 11:65775595-65775617
Sequence CTGTAAGCACCCAGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083919684_1083919692 -8 Left 1083919684 11:65775595-65775617 CCCAGCTTCCTGGGTGCTTACAG No data
Right 1083919692 11:65775610-65775632 GCTTACAGGGGATGGCAGGCAGG No data
1083919684_1083919693 21 Left 1083919684 11:65775595-65775617 CCCAGCTTCCTGGGTGCTTACAG No data
Right 1083919693 11:65775639-65775661 CGTTCTGATCCCAGCTCCAGTGG No data
1083919684_1083919694 22 Left 1083919684 11:65775595-65775617 CCCAGCTTCCTGGGTGCTTACAG No data
Right 1083919694 11:65775640-65775662 GTTCTGATCCCAGCTCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083919684 Original CRISPR CTGTAAGCACCCAGGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr