ID: 1083921310

View in Genome Browser
Species Human (GRCh38)
Location 11:65782441-65782463
Sequence TTCCTGCCTCACCGTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083921310_1083921317 30 Left 1083921310 11:65782441-65782463 CCACCCTCACGGTGAGGCAGGAA No data
Right 1083921317 11:65782494-65782516 GACAGGTTTCCAAGGATCAGGGG No data
1083921310_1083921313 13 Left 1083921310 11:65782441-65782463 CCACCCTCACGGTGAGGCAGGAA No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data
1083921310_1083921315 28 Left 1083921310 11:65782441-65782463 CCACCCTCACGGTGAGGCAGGAA No data
Right 1083921315 11:65782492-65782514 AAGACAGGTTTCCAAGGATCAGG No data
1083921310_1083921314 22 Left 1083921310 11:65782441-65782463 CCACCCTCACGGTGAGGCAGGAA No data
Right 1083921314 11:65782486-65782508 GTTGAGAAGACAGGTTTCCAAGG No data
1083921310_1083921316 29 Left 1083921310 11:65782441-65782463 CCACCCTCACGGTGAGGCAGGAA No data
Right 1083921316 11:65782493-65782515 AGACAGGTTTCCAAGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083921310 Original CRISPR TTCCTGCCTCACCGTGAGGG TGG (reversed) Intergenic