ID: 1083921311

View in Genome Browser
Species Human (GRCh38)
Location 11:65782444-65782466
Sequence TCATTCCTGCCTCACCGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083921311_1083921314 19 Left 1083921311 11:65782444-65782466 CCCTCACGGTGAGGCAGGAATGA No data
Right 1083921314 11:65782486-65782508 GTTGAGAAGACAGGTTTCCAAGG No data
1083921311_1083921318 28 Left 1083921311 11:65782444-65782466 CCCTCACGGTGAGGCAGGAATGA No data
Right 1083921318 11:65782495-65782517 ACAGGTTTCCAAGGATCAGGGGG No data
1083921311_1083921317 27 Left 1083921311 11:65782444-65782466 CCCTCACGGTGAGGCAGGAATGA No data
Right 1083921317 11:65782494-65782516 GACAGGTTTCCAAGGATCAGGGG No data
1083921311_1083921313 10 Left 1083921311 11:65782444-65782466 CCCTCACGGTGAGGCAGGAATGA No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data
1083921311_1083921315 25 Left 1083921311 11:65782444-65782466 CCCTCACGGTGAGGCAGGAATGA No data
Right 1083921315 11:65782492-65782514 AAGACAGGTTTCCAAGGATCAGG No data
1083921311_1083921316 26 Left 1083921311 11:65782444-65782466 CCCTCACGGTGAGGCAGGAATGA No data
Right 1083921316 11:65782493-65782515 AGACAGGTTTCCAAGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083921311 Original CRISPR TCATTCCTGCCTCACCGTGA GGG (reversed) Intergenic
No off target data available for this crispr