ID: 1083921312

View in Genome Browser
Species Human (GRCh38)
Location 11:65782445-65782467
Sequence ATCATTCCTGCCTCACCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083921312_1083921317 26 Left 1083921312 11:65782445-65782467 CCTCACGGTGAGGCAGGAATGAT No data
Right 1083921317 11:65782494-65782516 GACAGGTTTCCAAGGATCAGGGG No data
1083921312_1083921318 27 Left 1083921312 11:65782445-65782467 CCTCACGGTGAGGCAGGAATGAT No data
Right 1083921318 11:65782495-65782517 ACAGGTTTCCAAGGATCAGGGGG No data
1083921312_1083921315 24 Left 1083921312 11:65782445-65782467 CCTCACGGTGAGGCAGGAATGAT No data
Right 1083921315 11:65782492-65782514 AAGACAGGTTTCCAAGGATCAGG No data
1083921312_1083921314 18 Left 1083921312 11:65782445-65782467 CCTCACGGTGAGGCAGGAATGAT No data
Right 1083921314 11:65782486-65782508 GTTGAGAAGACAGGTTTCCAAGG No data
1083921312_1083921316 25 Left 1083921312 11:65782445-65782467 CCTCACGGTGAGGCAGGAATGAT No data
Right 1083921316 11:65782493-65782515 AGACAGGTTTCCAAGGATCAGGG No data
1083921312_1083921313 9 Left 1083921312 11:65782445-65782467 CCTCACGGTGAGGCAGGAATGAT No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083921312 Original CRISPR ATCATTCCTGCCTCACCGTG AGG (reversed) Intergenic
No off target data available for this crispr