ID: 1083921313

View in Genome Browser
Species Human (GRCh38)
Location 11:65782477-65782499
Sequence TCTTGCAGAGTTGAGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083921305_1083921313 23 Left 1083921305 11:65782431-65782453 CCGGCCCTCACCACCCTCACGGT No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data
1083921312_1083921313 9 Left 1083921312 11:65782445-65782467 CCTCACGGTGAGGCAGGAATGAT No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data
1083921302_1083921313 25 Left 1083921302 11:65782429-65782451 CCCCGGCCCTCACCACCCTCACG No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data
1083921310_1083921313 13 Left 1083921310 11:65782441-65782463 CCACCCTCACGGTGAGGCAGGAA No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data
1083921311_1083921313 10 Left 1083921311 11:65782444-65782466 CCCTCACGGTGAGGCAGGAATGA No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data
1083921308_1083921313 18 Left 1083921308 11:65782436-65782458 CCTCACCACCCTCACGGTGAGGC No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data
1083921306_1083921313 19 Left 1083921306 11:65782435-65782457 CCCTCACCACCCTCACGGTGAGG No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data
1083921303_1083921313 24 Left 1083921303 11:65782430-65782452 CCCGGCCCTCACCACCCTCACGG No data
Right 1083921313 11:65782477-65782499 TCTTGCAGAGTTGAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083921313 Original CRISPR TCTTGCAGAGTTGAGAAGAC AGG Intergenic
No off target data available for this crispr