ID: 1083921314

View in Genome Browser
Species Human (GRCh38)
Location 11:65782486-65782508
Sequence GTTGAGAAGACAGGTTTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083921306_1083921314 28 Left 1083921306 11:65782435-65782457 CCCTCACCACCCTCACGGTGAGG No data
Right 1083921314 11:65782486-65782508 GTTGAGAAGACAGGTTTCCAAGG No data
1083921310_1083921314 22 Left 1083921310 11:65782441-65782463 CCACCCTCACGGTGAGGCAGGAA No data
Right 1083921314 11:65782486-65782508 GTTGAGAAGACAGGTTTCCAAGG No data
1083921312_1083921314 18 Left 1083921312 11:65782445-65782467 CCTCACGGTGAGGCAGGAATGAT No data
Right 1083921314 11:65782486-65782508 GTTGAGAAGACAGGTTTCCAAGG No data
1083921308_1083921314 27 Left 1083921308 11:65782436-65782458 CCTCACCACCCTCACGGTGAGGC No data
Right 1083921314 11:65782486-65782508 GTTGAGAAGACAGGTTTCCAAGG No data
1083921311_1083921314 19 Left 1083921311 11:65782444-65782466 CCCTCACGGTGAGGCAGGAATGA No data
Right 1083921314 11:65782486-65782508 GTTGAGAAGACAGGTTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083921314 Original CRISPR GTTGAGAAGACAGGTTTCCA AGG Intergenic
No off target data available for this crispr