ID: 1083921315

View in Genome Browser
Species Human (GRCh38)
Location 11:65782492-65782514
Sequence AAGACAGGTTTCCAAGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083921311_1083921315 25 Left 1083921311 11:65782444-65782466 CCCTCACGGTGAGGCAGGAATGA No data
Right 1083921315 11:65782492-65782514 AAGACAGGTTTCCAAGGATCAGG No data
1083921312_1083921315 24 Left 1083921312 11:65782445-65782467 CCTCACGGTGAGGCAGGAATGAT No data
Right 1083921315 11:65782492-65782514 AAGACAGGTTTCCAAGGATCAGG No data
1083921310_1083921315 28 Left 1083921310 11:65782441-65782463 CCACCCTCACGGTGAGGCAGGAA No data
Right 1083921315 11:65782492-65782514 AAGACAGGTTTCCAAGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083921315 Original CRISPR AAGACAGGTTTCCAAGGATC AGG Intergenic
No off target data available for this crispr