ID: 1083921318

View in Genome Browser
Species Human (GRCh38)
Location 11:65782495-65782517
Sequence ACAGGTTTCCAAGGATCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083921312_1083921318 27 Left 1083921312 11:65782445-65782467 CCTCACGGTGAGGCAGGAATGAT No data
Right 1083921318 11:65782495-65782517 ACAGGTTTCCAAGGATCAGGGGG No data
1083921311_1083921318 28 Left 1083921311 11:65782444-65782466 CCCTCACGGTGAGGCAGGAATGA No data
Right 1083921318 11:65782495-65782517 ACAGGTTTCCAAGGATCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083921318 Original CRISPR ACAGGTTTCCAAGGATCAGG GGG Intergenic
No off target data available for this crispr