ID: 1083922048

View in Genome Browser
Species Human (GRCh38)
Location 11:65786532-65786554
Sequence CCGGTCCGCACTTGTTGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083922048_1083922062 24 Left 1083922048 11:65786532-65786554 CCGGTTCAACAAGTGCGGACCGG No data
Right 1083922062 11:65786579-65786601 TCGCGCCTCCCCAGGAGCCTCGG No data
1083922048_1083922061 16 Left 1083922048 11:65786532-65786554 CCGGTTCAACAAGTGCGGACCGG No data
Right 1083922061 11:65786571-65786593 CGGCGGCTTCGCGCCTCCCCAGG No data
1083922048_1083922052 -4 Left 1083922048 11:65786532-65786554 CCGGTTCAACAAGTGCGGACCGG No data
Right 1083922052 11:65786551-65786573 CCGGGCCGCCCGTTCCCGCCCGG No data
1083922048_1083922063 25 Left 1083922048 11:65786532-65786554 CCGGTTCAACAAGTGCGGACCGG No data
Right 1083922063 11:65786580-65786602 CGCGCCTCCCCAGGAGCCTCGGG No data
1083922048_1083922053 -1 Left 1083922048 11:65786532-65786554 CCGGTTCAACAAGTGCGGACCGG No data
Right 1083922053 11:65786554-65786576 GGCCGCCCGTTCCCGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083922048 Original CRISPR CCGGTCCGCACTTGTTGAAC CGG (reversed) Intergenic
No off target data available for this crispr