ID: 1083922077

View in Genome Browser
Species Human (GRCh38)
Location 11:65786609-65786631
Sequence GGGTTGGGCCGGCCCCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083922054_1083922077 30 Left 1083922054 11:65786556-65786578 CCGCCCGTTCCCGCCCGGCGGCT No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922056_1083922077 26 Left 1083922056 11:65786560-65786582 CCGTTCCCGCCCGGCGGCTTCGC No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922060_1083922077 16 Left 1083922060 11:65786570-65786592 CCGGCGGCTTCGCGCCTCCCCAG No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922072_1083922077 -10 Left 1083922072 11:65786596-65786618 CCTCGGGCGCGCCGGGTTGGGCC No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922059_1083922077 17 Left 1083922059 11:65786569-65786591 CCCGGCGGCTTCGCGCCTCCCCA No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922066_1083922077 -2 Left 1083922066 11:65786588-65786610 CCCAGGAGCCTCGGGCGCGCCGG No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922068_1083922077 -3 Left 1083922068 11:65786589-65786611 CCAGGAGCCTCGGGCGCGCCGGG No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922065_1083922077 -1 Left 1083922065 11:65786587-65786609 CCCCAGGAGCCTCGGGCGCGCCG No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922057_1083922077 21 Left 1083922057 11:65786565-65786587 CCCGCCCGGCGGCTTCGCGCCTC No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922064_1083922077 2 Left 1083922064 11:65786584-65786606 CCTCCCCAGGAGCCTCGGGCGCG No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922058_1083922077 20 Left 1083922058 11:65786566-65786588 CCGCCCGGCGGCTTCGCGCCTCC No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data
1083922055_1083922077 27 Left 1083922055 11:65786559-65786581 CCCGTTCCCGCCCGGCGGCTTCG No data
Right 1083922077 11:65786609-65786631 GGGTTGGGCCGGCCCCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083922077 Original CRISPR GGGTTGGGCCGGCCCCAGTG GGG Intergenic
No off target data available for this crispr