ID: 1083922078

View in Genome Browser
Species Human (GRCh38)
Location 11:65786617-65786639
Sequence GAAACTCGCCCCACTGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083922078_1083922082 -7 Left 1083922078 11:65786617-65786639 CCGGCCCCAGTGGGGCGAGTTTC No data
Right 1083922082 11:65786633-65786655 GAGTTTCGTGTCATCACCCGCGG No data
1083922078_1083922084 9 Left 1083922078 11:65786617-65786639 CCGGCCCCAGTGGGGCGAGTTTC No data
Right 1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083922078 Original CRISPR GAAACTCGCCCCACTGGGGC CGG (reversed) Intergenic
No off target data available for this crispr