ID: 1083922079

View in Genome Browser
Species Human (GRCh38)
Location 11:65786621-65786643
Sequence ACACGAAACTCGCCCCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083922079_1083922084 5 Left 1083922079 11:65786621-65786643 CCCCAGTGGGGCGAGTTTCGTGT No data
Right 1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083922079 Original CRISPR ACACGAAACTCGCCCCACTG GGG (reversed) Intergenic
No off target data available for this crispr