ID: 1083922082

View in Genome Browser
Species Human (GRCh38)
Location 11:65786633-65786655
Sequence GAGTTTCGTGTCATCACCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083922068_1083922082 21 Left 1083922068 11:65786589-65786611 CCAGGAGCCTCGGGCGCGCCGGG No data
Right 1083922082 11:65786633-65786655 GAGTTTCGTGTCATCACCCGCGG No data
1083922072_1083922082 14 Left 1083922072 11:65786596-65786618 CCTCGGGCGCGCCGGGTTGGGCC No data
Right 1083922082 11:65786633-65786655 GAGTTTCGTGTCATCACCCGCGG No data
1083922064_1083922082 26 Left 1083922064 11:65786584-65786606 CCTCCCCAGGAGCCTCGGGCGCG No data
Right 1083922082 11:65786633-65786655 GAGTTTCGTGTCATCACCCGCGG No data
1083922066_1083922082 22 Left 1083922066 11:65786588-65786610 CCCAGGAGCCTCGGGCGCGCCGG No data
Right 1083922082 11:65786633-65786655 GAGTTTCGTGTCATCACCCGCGG No data
1083922074_1083922082 3 Left 1083922074 11:65786607-65786629 CCGGGTTGGGCCGGCCCCAGTGG No data
Right 1083922082 11:65786633-65786655 GAGTTTCGTGTCATCACCCGCGG No data
1083922065_1083922082 23 Left 1083922065 11:65786587-65786609 CCCCAGGAGCCTCGGGCGCGCCG No data
Right 1083922082 11:65786633-65786655 GAGTTTCGTGTCATCACCCGCGG No data
1083922078_1083922082 -7 Left 1083922078 11:65786617-65786639 CCGGCCCCAGTGGGGCGAGTTTC No data
Right 1083922082 11:65786633-65786655 GAGTTTCGTGTCATCACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083922082 Original CRISPR GAGTTTCGTGTCATCACCCG CGG Intergenic
No off target data available for this crispr