ID: 1083922084

View in Genome Browser
Species Human (GRCh38)
Location 11:65786649-65786671
Sequence CCCGCGGAGCGTGCCAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083922081_1083922084 3 Left 1083922081 11:65786623-65786645 CCAGTGGGGCGAGTTTCGTGTCA No data
Right 1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG No data
1083922078_1083922084 9 Left 1083922078 11:65786617-65786639 CCGGCCCCAGTGGGGCGAGTTTC No data
Right 1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG No data
1083922079_1083922084 5 Left 1083922079 11:65786621-65786643 CCCCAGTGGGGCGAGTTTCGTGT No data
Right 1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG No data
1083922080_1083922084 4 Left 1083922080 11:65786622-65786644 CCCAGTGGGGCGAGTTTCGTGTC No data
Right 1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG No data
1083922074_1083922084 19 Left 1083922074 11:65786607-65786629 CCGGGTTGGGCCGGCCCCAGTGG No data
Right 1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG No data
1083922072_1083922084 30 Left 1083922072 11:65786596-65786618 CCTCGGGCGCGCCGGGTTGGGCC No data
Right 1083922084 11:65786649-65786671 CCCGCGGAGCGTGCCAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083922084 Original CRISPR CCCGCGGAGCGTGCCAGCGC CGG Intergenic
No off target data available for this crispr