ID: 1083922511

View in Genome Browser
Species Human (GRCh38)
Location 11:65788210-65788232
Sequence CGGGCCTGGCCCTCCGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083922511_1083922520 6 Left 1083922511 11:65788210-65788232 CCCACAGCGGAGGGCCAGGCCCG 0: 1
1: 0
2: 2
3: 19
4: 136
Right 1083922520 11:65788239-65788261 CTGGTGTACCCAGTTATTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083922511 Original CRISPR CGGGCCTGGCCCTCCGCTGT GGG (reversed) Intronic
900130207 1:1084193-1084215 CGGCCCTGGCCCTGCCTTGTGGG + Intronic
900420160 1:2552789-2552811 CTGGCCTGGCCCCCAGCTCTCGG + Intergenic
900424271 1:2568869-2568891 CTGGCCTGGCCCCCAGCTCTCGG - Intergenic
901007630 1:6179648-6179670 CGGGCCGGGGCCTGCGCTGGGGG - Intronic
901436774 1:9251343-9251365 CTGGCCAGGCCCTCAGCAGTTGG + Intronic
901797976 1:11691597-11691619 CGGGGCTGCCCCTCGGCTGGGGG + Exonic
903890830 1:26569389-26569411 GGGGCCTGGCCTTGTGCTGTGGG + Intronic
904447947 1:30589700-30589722 CGTGCCTGGCCCTGTGCTGTGGG - Intergenic
904773345 1:32893190-32893212 CGCTCCAGGCCCTCCACTGTCGG + Intronic
907484439 1:54767458-54767480 CGGGCCAGGCCCTCTGCTCAGGG - Intergenic
913109046 1:115641829-115641851 CGAGCCCCGCCCTCCGCTGCAGG + Intergenic
914753978 1:150552925-150552947 GGGCCCTGGCCCTCCTCTGTAGG - Exonic
914936921 1:151989687-151989709 CCTGCCTGGCCCTCCGTTCTTGG + Intronic
915462228 1:156076960-156076982 CGAGACTAGCCCCCCGCTGTGGG - Exonic
915920284 1:159971282-159971304 TGGCCTTTGCCCTCCGCTGTGGG - Intergenic
919726827 1:200890203-200890225 CGCGCCTGGCCGTTCGTTGTGGG + Intergenic
1062960962 10:1573472-1573494 CCGGCCTGGCTCTCTGCTGATGG - Intronic
1063313433 10:4978470-4978492 CAGGCCTGACTCTCAGCTGTGGG - Exonic
1063314519 10:4989247-4989269 CAGGCCTGACTCTCAGCTGTGGG + Exonic
1070962640 10:80509728-80509750 CGTGCCCGGCCCTCCTCTTTCGG + Intronic
1073057933 10:100714023-100714045 AGGGCCTGGGACTCCGCTGGTGG + Intergenic
1075769009 10:124917412-124917434 GGGGCCCGGGCCGCCGCTGTCGG + Intergenic
1077148050 11:1054605-1054627 CCGCCCTGGCCCGCAGCTGTTGG + Intergenic
1077480558 11:2812558-2812580 CGGGGCTGGCCCTCCTCTCCGGG - Intronic
1077532689 11:3104585-3104607 CGGGCCTGGACCTGGGCTGCGGG - Intronic
1077630611 11:3808727-3808749 AGGGCCGGGCCCCACGCTGTGGG + Intronic
1078128657 11:8593917-8593939 CGGCCCGGTCCCTCCGCTGGGGG + Intronic
1081649975 11:44817383-44817405 CTGGCCTGGCCCTAGGCTTTCGG + Intronic
1083309654 11:61777715-61777737 CGGGCCTGGCTCCCCGCAGGTGG + Exonic
1083492937 11:63026658-63026680 CAGGCCTGGCTTTCCGCAGTGGG + Intergenic
1083571615 11:63764538-63764560 CGGGACTCGGCCTCCGCTGCTGG - Exonic
1083922511 11:65788210-65788232 CGGGCCTGGCCCTCCGCTGTGGG - Intronic
1084417829 11:69043648-69043670 AGGGCCTGGACCTCCGCTATTGG + Intergenic
1085013129 11:73155157-73155179 CAGGCCTGAGCCTCCGCTCTCGG + Intergenic
1089045940 11:115502906-115502928 CGGGCCTGGGGCTCCGCAGGTGG + Intronic
1091097926 11:132841410-132841432 CAGGCCTGGCCCTCTACAGTGGG - Intronic
1092263105 12:6962893-6962915 CTGGCCTGCAGCTCCGCTGTGGG + Intergenic
1096695122 12:53344265-53344287 CTGCCCTGGCCCTTCACTGTTGG - Intronic
1102349765 12:112183946-112183968 AGGGCCTGGCCTTCCGCGGTGGG - Intronic
1102871257 12:116416020-116416042 CGGGGCGTGCCCTCCGCTGTGGG + Intergenic
1104647746 12:130509113-130509135 CGAGCCTGGCCCTTGGCTGGAGG + Intronic
1105069916 12:133228009-133228031 CAGGCCTGGCCCTCTGCAGAAGG + Intronic
1113939253 13:114010088-114010110 CCAGCCAGGCCCTGCGCTGTGGG - Intronic
1121254185 14:92519475-92519497 CCTGCCTGGCCATCAGCTGTGGG + Intronic
1122480246 14:102042540-102042562 CTGGCCTGGCACTGTGCTGTCGG + Intronic
1122805287 14:104253383-104253405 CAGGCCAGGCCCTCTGCTGTGGG + Intergenic
1123036633 14:105474475-105474497 GGAGCCTGGCCCTCGGCTCTCGG - Intronic
1123048148 14:105528272-105528294 CGGGCCTGCCCCTCCGCTCTTGG - Intronic
1124268176 15:28256118-28256140 CGGGCCCGCTCCTCCGCGGTGGG + Exonic
1126761199 15:51971635-51971657 CGTGGCAGGCCTTCCGCTGTGGG - Intronic
1131833651 15:96369647-96369669 GGGGCCTGGCCCTCAGCGGCAGG + Intergenic
1132600381 16:770348-770370 TGGGTCTGGCCCTACCCTGTGGG - Intronic
1132821153 16:1871937-1871959 CGGGCCAGGCCTCCAGCTGTGGG - Intronic
1132835476 16:1950818-1950840 AGCCCCCGGCCCTCCGCTGTCGG - Intronic
1134007663 16:10828898-10828920 CATGCCTGGCCCTCCGCCGCAGG + Intergenic
1136487354 16:30582124-30582146 CAGGCCTGTCCCTCGGCTGGTGG - Exonic
1136682594 16:31976716-31976738 CGGGACCAGCCCTCTGCTGTGGG + Intergenic
1136782855 16:32917884-32917906 CGGGACCGGCCCTCTGCTGTGGG + Intergenic
1136886941 16:33935966-33935988 CGGGACCGGCCCTCTGCTGTGGG - Intergenic
1139471039 16:67178393-67178415 CTGGCCAGGCCCTCCTCCGTGGG + Exonic
1142198410 16:88749509-88749531 TGGGGCTGGCCATCCTCTGTTGG - Intronic
1203085503 16_KI270728v1_random:1181868-1181890 CGGGACCGGCCCTCTGCTGTGGG + Intergenic
1142468336 17:148304-148326 TGGGCCTGGGCCTCCGCCGGGGG + Intronic
1143954191 17:10656057-10656079 GGGCCCTGTCCCTCGGCTGTTGG - Intronic
1146276893 17:31522043-31522065 TGGGCCTGGGCCTCACCTGTTGG - Exonic
1147143115 17:38470056-38470078 CGGGACCCGCCCTCTGCTGTGGG + Intronic
1147443908 17:40463390-40463412 TGGGCCTGGGCCTGGGCTGTAGG - Intergenic
1152293629 17:79454402-79454424 CGGGGCTGGGCCTCCGCAGAGGG - Intronic
1153332371 18:3886992-3887014 CGGATATGGCACTCCGCTGTAGG - Intronic
1155218304 18:23662555-23662577 CGGGCCTCGCCCGCAGCTGGAGG + Intronic
1160190050 18:76708341-76708363 CGGGCCTGGCCCTCTGCTCGGGG + Intergenic
1160987088 19:1844068-1844090 CAGGCCTGGCTCTCCGGTGTCGG - Intronic
1161563319 19:4985750-4985772 CGGTCCTGGCCCAACGCTGGGGG - Intronic
1161576670 19:5058343-5058365 CGGGCCTGGCACTGCTCTGGGGG - Intronic
1161950876 19:7467195-7467217 TGGCCCTGGCCCTCCGCAGGCGG + Exonic
1162043278 19:7983251-7983273 CGGGCCTGGTCCTACGGTCTTGG - Intronic
1162931518 19:13960047-13960069 CGGAGCTGGCCCTCCTCAGTGGG - Exonic
1165313938 19:35043543-35043565 CAGGCCTCGCCCCACGCTGTTGG - Intronic
1166365537 19:42276506-42276528 CTGGCCTGGCCCTTCCCTTTTGG + Intronic
1166688766 19:44810696-44810718 CAGGCCTGGCCCTGCCCTGGGGG + Intronic
1167083505 19:47293411-47293433 CGGGCCTAGCCCTCTCCTCTCGG + Intronic
928094118 2:28393562-28393584 CTGTCCTCGCCCTCCGCGGTGGG + Exonic
929701940 2:44169444-44169466 CGGGCCTGGCTCTCGGGTATAGG + Intronic
930411103 2:51027626-51027648 CGGGCTTCCCCCGCCGCTGTTGG + Exonic
932496766 2:72149425-72149447 CCGGCCAGGACCTCCGCTGCCGG - Intergenic
933678448 2:85078196-85078218 AGAGCCTGGCCCTCGGCAGTGGG + Intergenic
933684689 2:85133652-85133674 CGGGCCGGGGCCGCCGCTCTCGG - Exonic
934781599 2:96972676-96972698 GGGCCCAGGCCCTCCTCTGTGGG - Intronic
937986135 2:127638935-127638957 CTGGCCTGGCCCTCCCCAGGCGG - Exonic
938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG + Intergenic
941110316 2:161414377-161414399 CGGGCAAGGCCCTGCGCTGGCGG - Intergenic
947635938 2:231680893-231680915 AGGGGCTGGGCCACCGCTGTGGG - Intergenic
948867602 2:240783563-240783585 CGGGCATGGCCCTCGGCTGCTGG + Intronic
1168860579 20:1043554-1043576 CGGGAATGGCCCTCAGCTGTAGG - Intergenic
1169141368 20:3229042-3229064 GGGGCCCGGGCCTCTGCTGTGGG - Intronic
1174369022 20:50073718-50073740 TGGGCCTGGCCTTCCTCTCTTGG - Intergenic
1174463481 20:50699485-50699507 CGGGCATGGCCCTCCCTTGAGGG - Intergenic
1175522694 20:59612254-59612276 AGGGCCGGGACTTCCGCTGTGGG + Intronic
1175837462 20:62005196-62005218 CGGGCCAGGCCCTGCGGTGCAGG + Intronic
1177228972 21:18294354-18294376 GGGGCCTGGCCCTGGGTTGTGGG - Exonic
1178534983 21:33403623-33403645 CGGGCCTGGGCCTCCGCGGCGGG + Intronic
1180933053 22:19606281-19606303 CGGCCCTGGCCCTTCTGTGTCGG - Intergenic
1181031575 22:20150763-20150785 GGAGCCTCGCCCTCCACTGTGGG + Exonic
1181147444 22:20858865-20858887 CGGGGCGGGCCCACCGCTGCAGG + Intronic
1182226215 22:28800599-28800621 CGGTCGTGGCCCTCCGCGATTGG + Intergenic
1182358353 22:29732905-29732927 CAGGCCTGGCCCTGCGCCTTGGG - Intronic
1184867477 22:47209626-47209648 AGGAGCTGGCCCTCCCCTGTGGG - Intergenic
1185296650 22:50058118-50058140 CGGGCCTGGGGTTCCGCGGTCGG + Intergenic
950045647 3:9947252-9947274 CAGCCCGGGCCCTCGGCTGTTGG - Exonic
953916218 3:46922670-46922692 CGGCCCAGCCCCTCCACTGTGGG + Intronic
954714218 3:52519026-52519048 TGGGCCTCGCCCACTGCTGTGGG + Intronic
956410502 3:68973805-68973827 CAGGCCTTGCCCTCAGCTGAAGG + Intergenic
961636985 3:128339672-128339694 CGGGCCTTGCACTCTACTGTGGG + Intronic
961858157 3:129893360-129893382 CGGGCCTGGCCTCCCGCTCGCGG - Intronic
967055344 3:185825109-185825131 CGGGCCGGGCCGGCCGCGGTGGG - Intergenic
969188606 4:5498986-5499008 CTGGCCTCCCCCTCGGCTGTCGG - Exonic
969563663 4:7965086-7965108 AGGGCCAGGCCCTCTGCTGATGG - Intergenic
973619386 4:52712255-52712277 CGGGCCCGGCCATTGGCTGTCGG - Intergenic
976704245 4:88005358-88005380 CAGGCCTGGCTCTCCTCTGTTGG + Intergenic
981090501 4:140727375-140727397 CTGGCCTGCCCCACTGCTGTGGG - Intronic
986026277 5:3854449-3854471 CGGGCCTGGCCCGGCTTTGTGGG + Intergenic
987108544 5:14664230-14664252 CGGGCTTGGGCCTCCGCTGTCGG - Intergenic
993168368 5:84384626-84384648 CGGGCTCAGCCCTCCGCTGCGGG + Exonic
998693465 5:144613329-144613351 CGGGCCTGTACTTCAGCTGTGGG + Intergenic
1002931901 6:1640666-1640688 CAGCCCTGGGCCTGCGCTGTGGG - Intronic
1005883212 6:30075439-30075461 CGTGTCTGGCCCGCCGCTGGGGG - Exonic
1006107796 6:31727225-31727247 AAGGCCAGGCCCTCAGCTGTGGG + Exonic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006978333 6:38124416-38124438 CCCGCCTGGCCCCCCGCTGTGGG - Intronic
1017759463 6:157556806-157556828 CGGGCCTGTCCTTCAGCTGGTGG - Intronic
1019167558 6:170108676-170108698 CGCGCCTGGCCCTGAGCTGAGGG + Intergenic
1019214425 6:170434203-170434225 CCGGCCTGGACCTCAGCTGATGG + Intergenic
1020116198 7:5477907-5477929 GGGGCCCAGCCCTCAGCTGTTGG + Intronic
1020138199 7:5598218-5598240 GGTGCCTGGCCCCCCGCGGTGGG + Intronic
1021217905 7:17940174-17940196 TGGGCCTGACCCTTCGCCGTGGG - Intronic
1023930103 7:44700299-44700321 GAGGCCTGGCCCTGCCCTGTTGG + Intronic
1024047149 7:45592619-45592641 TGTCCCTGGCCCTGCGCTGTGGG + Intronic
1027911497 7:84257601-84257623 AGGCCCTGGCCATCCTCTGTGGG - Intronic
1029283715 7:99452445-99452467 CGTGCCTGGCCTTCCTCGGTAGG + Intronic
1034275497 7:149822081-149822103 CGGGCCTGGCCTCTCGCTCTGGG + Intergenic
1034331630 7:150288125-150288147 CTGCCCTGGCCCTGCTCTGTGGG - Intronic
1034492749 7:151402700-151402722 CTGGCATGGCCCTCCACTCTTGG - Intronic
1036242632 8:7092576-7092598 CGGGGCTGCCCCTCCCCTTTTGG - Intergenic
1037907956 8:22726588-22726610 CGGGCCAGGCCCTGGGCTGTAGG + Intronic
1039431426 8:37528288-37528310 CATGCCTGGCTCTCTGCTGTGGG - Intergenic
1041705802 8:60845021-60845043 CGAGTCTGGCCATCCGCTGTGGG - Exonic
1047256221 8:123215383-123215405 TGTGCCTGGCCCTGTGCTGTAGG - Intergenic
1048992398 8:139768409-139768431 AGGGCCTGGCCCACCACTGGTGG - Intronic
1048992577 8:139770011-139770033 AGGGCCTGGCCCACCACTGGCGG - Intronic
1049392672 8:142380253-142380275 CGGGCCTTGCCCTCCGCAGATGG + Intronic
1049671039 8:143869979-143870001 CGCCCCTGGCCGTCCGGTGTGGG + Exonic
1051287481 9:15511222-15511244 CGGGCCCGGCCCGCCCCTGCTGG + Intergenic
1057878039 9:98772586-98772608 GGGCCCTGGCCCCCCACTGTGGG + Intronic
1060949881 9:127594817-127594839 CGAGTCTGGCCCTGCCCTGTTGG - Intergenic
1061221201 9:129253280-129253302 CAGGCCTGTGCCTCAGCTGTGGG + Intergenic
1062213467 9:135376853-135376875 CTGCCCTGGCCCTCCGCCCTGGG - Intergenic
1062262865 9:135671566-135671588 TGGCCCTGGCACTGCGCTGTGGG - Intergenic
1187154739 X:16712397-16712419 CTGGCCTGGCGCTCACCTGTCGG + Intronic