ID: 1083923299

View in Genome Browser
Species Human (GRCh38)
Location 11:65791834-65791856
Sequence GGACAGAGAGCACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083923295_1083923299 0 Left 1083923295 11:65791811-65791833 CCTTGCCGGAAACATCTAATTAG 0: 1
1: 0
2: 1
3: 4
4: 60
Right 1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 217
1083923294_1083923299 3 Left 1083923294 11:65791808-65791830 CCGCCTTGCCGGAAACATCTAAT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 217
1083923298_1083923299 -5 Left 1083923298 11:65791816-65791838 CCGGAAACATCTAATTAGGGACA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 217
1083923293_1083923299 6 Left 1083923293 11:65791805-65791827 CCACCGCCTTGCCGGAAACATCT 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG 0: 1
1: 0
2: 2
3: 25
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083923299 Original CRISPR GGACAGAGAGCACCACAAGC AGG Intronic
900761471 1:4474562-4474584 GGACAGTGAGCACCAGATTCAGG - Intergenic
900775612 1:4582773-4582795 GCCCAGAGAGACCCACAAGCTGG + Intergenic
901031181 1:6307846-6307868 GGGCAGAGGGAACCACAAACAGG + Intronic
901031193 1:6307906-6307928 GGGCAGAGGGAACCACAAACAGG + Intronic
903012375 1:20340286-20340308 TCACAGAGAGCAACAGAAGCTGG - Intronic
904934840 1:34122811-34122833 GGACAGAGAGGCCCACTAGAGGG + Intronic
905180415 1:36162157-36162179 GCACAGACAGCACCTCAGGCAGG - Intronic
907053631 1:51345532-51345554 GGGCACAGAGCACCAGCAGCAGG + Intergenic
910356884 1:86367604-86367626 GGGCAAAGAGTACAACAAGCAGG + Intronic
912885850 1:113473438-113473460 GGGCAGAGAGCATCACAAACTGG - Intronic
913333513 1:117686582-117686604 GGGCAGAGAGCACCCCTAGGAGG - Intergenic
913609939 1:120501218-120501240 GGTCAGACTGCAGCACAAGCTGG - Intergenic
913984855 1:143555625-143555647 GGTCAGACTGCAGCACAAGCTGG + Intergenic
914203876 1:145509920-145509942 GGTCAGACTGCAGCACAAGCTGG + Intergenic
914581250 1:149021023-149021045 GGTCAGACTGCAGCACAAGCTGG + Exonic
916384994 1:164256884-164256906 GGCCAGAGAGCATTAGAAGCTGG + Intergenic
920202875 1:204270849-204270871 GGATGGAGAGAACCAGAAGCAGG - Intronic
920458367 1:206117564-206117586 GGACAGGGAGCGAGACAAGCAGG + Intronic
923617443 1:235549451-235549473 GTACAGAGAGCATCAAAATCAGG - Exonic
1063088583 10:2841552-2841574 GTGCAGAGAGCACCTCAACCCGG - Intergenic
1064642820 10:17431598-17431620 GGACAGAGAGGATCTCACGCTGG - Intronic
1065453178 10:25879997-25880019 GGCCAGAGAGCAGCATCAGCTGG + Intergenic
1066454654 10:35562484-35562506 GGACAGTGATCACCAGGAGCTGG - Intronic
1067197317 10:44133195-44133217 GCACAGAGAGCAGCACAGGCAGG + Intergenic
1069772206 10:70907173-70907195 GGACAGCGAGCAGCAGAAGTGGG - Intergenic
1071722258 10:88159137-88159159 GGAAAGAGAGCAGAAAAAGCAGG - Intergenic
1072937106 10:99723977-99723999 TGACAGTGAGGTCCACAAGCTGG + Exonic
1076417409 10:130301312-130301334 GGACAGCGAGCAGCTCAGGCTGG - Intergenic
1076417538 10:130301788-130301810 GGACAGCGAGCAGCTCAGGCTGG - Intergenic
1076724043 10:132405124-132405146 GGACAGGGAGCTCCGCAAGCCGG + Exonic
1077094393 11:793165-793187 GGACAGACGGCCCCACAGGCAGG + Intronic
1078678550 11:13451352-13451374 GGACAAAGACCACCACTAGCAGG + Intronic
1079658657 11:23014155-23014177 GCACAGTGAGGGCCACAAGCAGG - Intergenic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1081138655 11:39470729-39470751 TGCCAGAAAGCACCAAAAGCTGG - Intergenic
1081360739 11:42174789-42174811 GGACAGGGGGCACCATAAACAGG - Intergenic
1081460614 11:43269381-43269403 GGACTGAGAGCACAGCAGGCCGG + Intergenic
1081679856 11:44994601-44994623 GCACAGTGGGCACCACATGCAGG + Intergenic
1083155336 11:60819427-60819449 GGACAGAGAGCCCCATGACCAGG + Intergenic
1083902713 11:65651351-65651373 GAACAGAGAGGACCATAGGCTGG - Intergenic
1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG + Intronic
1083938624 11:65883262-65883284 GGACAGAGTGGTCCACAAGCTGG - Exonic
1084004454 11:66315662-66315684 TGGCAGAGACCACCACAGGCCGG + Exonic
1084517828 11:69646040-69646062 GCACAGACAGCACCACACACTGG + Intronic
1084659690 11:70539587-70539609 TCACAGACAGCACCACAGGCTGG + Intronic
1088412500 11:109550550-109550572 GGAGAGAGAACATCTCAAGCAGG - Intergenic
1089081065 11:115776661-115776683 GGACAGAGGGCCCCAGAGGCAGG + Intergenic
1089438144 11:118489175-118489197 TGACAGACTGCACCACAGGCTGG - Intronic
1089456315 11:118627922-118627944 TGACTGAGAGCACCAGAAGCTGG - Exonic
1090531530 11:127595800-127595822 GGACAGATAGAAGCACCAGCAGG + Intergenic
1093496286 12:19762128-19762150 GGACAAAGAACACCATGAGCTGG - Intergenic
1093625549 12:21342911-21342933 GGACAGAGAGCAGCTCTAGGGGG + Intronic
1096576804 12:52557888-52557910 GGCCAGAGGGCTCCCCAAGCAGG - Intergenic
1101230811 12:102739153-102739175 GGAAAGAGAGCAGCAGAAGAAGG - Intergenic
1102444327 12:112990047-112990069 GGAAAGAGAGCACCAGCTGCAGG - Intronic
1103480047 12:121244974-121244996 GGACAGTCAGCACCCCAACCTGG - Intronic
1104299001 12:127546914-127546936 GGACAGACATCACCCCAGGCAGG - Intergenic
1105837397 13:24223431-24223453 GGCCTGAGGGCACCACATGCTGG - Exonic
1107944772 13:45407972-45407994 AGACAGGGAGCACTAGAAGCAGG - Intronic
1109046212 13:57414532-57414554 AGACAGGCAGCAACACAAGCTGG + Intergenic
1112871221 13:103973183-103973205 GGACAGAAAACACCTGAAGCTGG - Intergenic
1113408986 13:110067259-110067281 GTACAGAGAGCATCTAAAGCAGG - Intergenic
1114408030 14:22474565-22474587 GGACAGAGACCACCCAAAGAAGG + Intergenic
1121091780 14:91187957-91187979 GTACAGACAGCACCATTAGCTGG - Intronic
1121124697 14:91398721-91398743 GGACAGGGAGCACCACAGGCTGG + Intronic
1121175246 14:91885976-91885998 GGACAGTCAGAGCCACAAGCAGG - Intronic
1121242398 14:92440151-92440173 GGACACTGAGCTCCCCAAGCTGG - Intronic
1122113018 14:99514816-99514838 GGACAGAGACCACCACTACCTGG - Exonic
1124823188 15:33067974-33067996 GGACAGAGAGCAACAGGACCCGG + Intronic
1126581931 15:50250059-50250081 GGACAGAGAGCACCAGTGGAGGG - Intronic
1132023042 15:98381343-98381365 AGACAGAGAGCACCAATAACTGG + Intergenic
1132288187 15:100681004-100681026 GGAAGGAGAGTCCCACAAGCAGG - Intergenic
1134037147 16:11039880-11039902 GGACAGACAACACCCCAAGTGGG - Intronic
1134739622 16:16530963-16530985 GGACAGAGATCACCACGAGATGG + Intergenic
1134927877 16:18181189-18181211 GGACAGAGATCACCACGAGATGG - Intergenic
1135142778 16:19935919-19935941 GGACAGACAGGAACACATGCAGG - Intergenic
1136692004 16:32039315-32039337 GGTCACAGAGAACCACAAGGGGG + Intergenic
1138482680 16:57314235-57314257 GGAGAGAGAGGACCACAGTCAGG + Intergenic
1139507297 16:67405371-67405393 GGACAGAGCTCACCACAGGCTGG + Intronic
1141451365 16:84105679-84105701 GGGAAGAGAGGACCTCAAGCAGG + Intronic
1141563732 16:84887256-84887278 AGACAGAGGCCACCACCAGCAGG - Intronic
1142250703 16:88990507-88990529 GGGCAGAGGCCACGACAAGCCGG - Intergenic
1145063224 17:19745139-19745161 GGACAGAGAGCACCTGCAGCTGG + Exonic
1145993039 17:29090624-29090646 GGAATGAGAGCATCAGAAGCAGG + Intronic
1149846963 17:60013972-60013994 GGATAGAGGGCACCAAATGCTGG - Intergenic
1151128957 17:71875968-71875990 GGACAGTGAGCCCCAAAAGAAGG + Intergenic
1152858035 17:82677416-82677438 GGGCAGAAAGCATTACAAGCCGG + Intronic
1152896181 17:82912718-82912740 GGACAGAAAGCACAAGAGGCTGG - Intronic
1153020494 18:624181-624203 GTACAGCAAGCACCACAAGGGGG + Intronic
1153730626 18:8007968-8007990 ATAAAGACAGCACCACAAGCGGG - Intronic
1153816264 18:8792911-8792933 GGACAGACATCTGCACAAGCTGG - Intronic
1154405962 18:14091678-14091700 GGACACAGAGCATCAGAAGGTGG + Intronic
1156144291 18:34157700-34157722 GGTCAGAGAGCACAAGAAGATGG + Intronic
1160413097 18:78688144-78688166 GGACAGAGAATGCCACATGCTGG - Intergenic
1160413110 18:78688220-78688242 GGACAGAGAATACCACATGCTGG - Intergenic
1160413116 18:78688252-78688274 GGACAGAGAATGCCACATGCTGG - Intergenic
1160413122 18:78688284-78688306 GGACAGAGAATGCCACATGCTGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161986645 19:7658712-7658734 TGACAGAGAGGAGAACAAGCTGG + Intergenic
925257440 2:2502282-2502304 GGCCAGAGTGCACCACATACAGG - Intergenic
925439845 2:3875978-3876000 GGACAGCTAGCACCAGCAGCTGG - Intergenic
925838783 2:7970989-7971011 GGACTGAGAGGACCACAGGGTGG + Intergenic
926861751 2:17317395-17317417 GGTCAGAGACCTCCTCAAGCTGG + Intergenic
929570570 2:43020369-43020391 GGAGAGAGGGCCCCAGAAGCAGG + Intergenic
931232759 2:60388454-60388476 GGACAGAGAGGACCTGAGGCTGG + Intergenic
933174789 2:79163477-79163499 GGACTGAGAGCAGGACTAGCTGG - Intergenic
934724403 2:96606143-96606165 GGAGAGAGAGTACCTCAACCAGG + Intronic
935061848 2:99615480-99615502 GCCCAGAGAGAACCTCAAGCAGG + Intronic
935120569 2:100180253-100180275 ACACAGAGAGCACCACAAACTGG - Intergenic
935528233 2:104199267-104199289 GGAGAAAGAGGACCACAACCAGG - Intergenic
936560319 2:113532768-113532790 GGACAGAGAGAAGCACAAGGCGG - Intergenic
937247405 2:120502663-120502685 GGTCAGACAGCACCATCAGCTGG - Intergenic
937516397 2:122660822-122660844 GGACAGAGAGGACCGCAGCCTGG - Intergenic
938812067 2:134862927-134862949 GGACAGAGAGGAGGACAGGCAGG + Intronic
946285255 2:218697875-218697897 AGACAGAGAGCACCACGACAGGG - Exonic
947531394 2:230910731-230910753 GGAGGGAGAGCACCAGCAGCAGG + Exonic
947610615 2:231522823-231522845 GGACAGAGAGCAACAGAGGCTGG - Intergenic
947968317 2:234300937-234300959 GCAAAGAGAGAACCAGAAGCAGG - Intergenic
948210188 2:236187261-236187283 TGGCTGTGAGCACCACAAGCAGG + Intergenic
948979320 2:241485094-241485116 TGACAGGGAGGACCACAAGGAGG - Intronic
1169227340 20:3864890-3864912 GGCCACAGAGCAGCACAGGCTGG - Intronic
1169318806 20:4614178-4614200 GGACAGAGAACACAACAGTCAGG + Intergenic
1171006314 20:21468615-21468637 TGCCAAGGAGCACCACAAGCTGG - Intergenic
1173257570 20:41405628-41405650 GGCCAGAGAGCTGCACAAGTAGG - Intronic
1175525697 20:59631932-59631954 GGACAGAGGCTACCACAGGCCGG - Intronic
1175553400 20:59831376-59831398 GGACAGAGAGCAGCATCTGCCGG - Intronic
1178664129 21:34531979-34532001 GTATAGAGACCACCACAACCAGG + Intronic
1179455168 21:41494351-41494373 GGACAGTGTGCACCTCAAGTAGG - Exonic
1179955946 21:44738676-44738698 GGACAGAGAGCCCAATTAGCTGG - Intergenic
1181515691 22:23410519-23410541 GTAGAAACAGCACCACAAGCTGG - Intergenic
1181548982 22:23625460-23625482 GGAAAGGGAGCCCAACAAGCAGG - Intronic
1183520089 22:38291747-38291769 GGGCAGCGGGCACCACAAGGGGG + Exonic
1183737039 22:39649904-39649926 GGGCATCGAGCACCACGAGCAGG + Exonic
1183740709 22:39667025-39667047 GTACAGAGAACACCCCACGCAGG - Intronic
1184976248 22:48064445-48064467 GGACCCAGAGCAGCACAAGCTGG + Intergenic
1185140460 22:49098012-49098034 GGAGAGACAGCAGCACATGCTGG - Intergenic
1185250527 22:49799395-49799417 GGACAGAGGCCTCCGCAAGCTGG + Intronic
949906103 3:8859779-8859801 GGAGAAAGAGCACCATATGCTGG - Intronic
949939865 3:9146728-9146750 AGACAGAGAGCACCAGGACCAGG + Intronic
950329218 3:12143077-12143099 TGACAGAGAGGCCCAAAAGCAGG + Intronic
950423211 3:12910701-12910723 GGACAGAGAGCCCCAGATCCAGG + Intronic
952063853 3:29543073-29543095 GGACAGAGACCACCACATATGGG + Intronic
952238724 3:31507610-31507632 TGACAGAGAACAACACAACCTGG + Intergenic
952547800 3:34440003-34440025 GTCCAGAGAGAACCACACGCAGG + Intergenic
952578489 3:34803296-34803318 GGACAGAAAGCTCCACAGGTTGG - Intergenic
952872842 3:37917202-37917224 GGACAGAGACAAACACAAGAGGG + Intronic
954579316 3:51694660-51694682 TGGCAGAGAGCACCCCAGGCAGG - Intronic
957379709 3:79410804-79410826 GGACTGCAAGCAGCACAAGCTGG - Intronic
959500933 3:107105354-107105376 GGACGAAGTGCACCATAAGCAGG - Intergenic
961269610 3:125679413-125679435 TAACAGAGAGCTCCACCAGCAGG - Intergenic
961312663 3:126013599-126013621 GGACAGAGATGATCACAGGCAGG + Intronic
962102538 3:132357676-132357698 GGAAAGAGAGCACCACGTGATGG + Intronic
966902157 3:184494329-184494351 GGAAAGAAAGGGCCACAAGCAGG - Intronic
968284793 3:197502182-197502204 GGGCAGAGGGCACAGCAAGCTGG + Intergenic
968446517 4:655015-655037 GCACACAGAGCACCACAGGTGGG - Intronic
972889883 4:43544075-43544097 AGACAGAGACCACCAGAAGAGGG + Intergenic
975440143 4:74400618-74400640 AGCCAGAGAACACCGCAAGCAGG + Intergenic
975481995 4:74891036-74891058 GAACAGAGAGGAACAGAAGCAGG + Intergenic
976242027 4:82967763-82967785 ACACAGAGGGCACCAGAAGCTGG + Intronic
976745590 4:88400040-88400062 GGACAAAGAGCTCGACAAGATGG + Intronic
978204774 4:106068324-106068346 GGGCAGGGAGCACCACACACTGG - Intronic
978832463 4:113104926-113104948 GGACAGTGAGCAGCAGAAACAGG + Intronic
979000415 4:115210329-115210351 GGGCAGGGAACATCACAAGCTGG + Intergenic
979415933 4:120438908-120438930 TGACAGAGAGCTCAACCAGCAGG - Intergenic
983495558 4:168438662-168438684 TGTCACAAAGCACCACAAGCTGG - Intronic
983655017 4:170073961-170073983 AGACATAGACAACCACAAGCTGG - Intronic
984016010 4:174427784-174427806 GGTCAGAGAGCAACTCAAGTAGG + Intergenic
985491433 5:181973-181995 GGACAGAAAGCACGTCAGGCTGG - Intronic
986424903 5:7621621-7621643 GTACAGAGAGCAGCGCAATCAGG - Intronic
986707078 5:10461164-10461186 GGACTGGGAGCACCACAGCCAGG - Exonic
988261659 5:28894390-28894412 GGAGAGAGAGTTCCTCAAGCAGG - Intergenic
991296597 5:65088151-65088173 GCACAGACAGCACCATTAGCAGG - Intergenic
993040100 5:82804581-82804603 GGTGAGAGAGCACCTCATGCGGG - Intergenic
998350233 5:141495437-141495459 AGACAGAGAGCAGGACAAGTAGG - Intronic
999631892 5:153580016-153580038 GGAAACAGAGGACCACAAGTAGG + Intronic
1000200846 5:159009239-159009261 GGACAGACAGAACCACAAAGTGG - Intronic
1001590509 5:172861301-172861323 GGACAGAGGGCACTGCAGGCTGG - Intronic
1001616645 5:173048228-173048250 GGACAGAGAGCTGAAGAAGCTGG + Intergenic
1002537583 5:179885998-179886020 AGGCAGAGAGCACAGCAAGCTGG - Intronic
1005174449 6:23028569-23028591 GCACATAGAGCAAAACAAGCAGG + Intergenic
1005290553 6:24374918-24374940 GGACACTGGTCACCACAAGCTGG - Intergenic
1009373499 6:62938432-62938454 GGGCAGTGTGCACCACAACCTGG - Intergenic
1011441443 6:87391423-87391445 TAACATAGAGCACCACAATCTGG - Intronic
1015121101 6:129702514-129702536 GGACAGAGGGCACCTACAGCAGG + Intronic
1015710075 6:136129785-136129807 GGACAGAGAGAAGCAGAAGGTGG - Intronic
1017755571 6:157526400-157526422 GGACAGAGGCCACCAGAAGAGGG - Intronic
1018350771 6:162956616-162956638 TGACTGAGACCACCAGAAGCTGG - Intronic
1018379367 6:163243654-163243676 GGACAGACAGGACCAGAACCTGG - Intronic
1019623603 7:2004169-2004191 GGCCAGAGAGCAGCCCAAACAGG + Intronic
1022499630 7:30874346-30874368 GGACAGAGAGAACCAGATGTGGG + Intronic
1023728125 7:43164726-43164748 GGACAGAGAGCGCCACATCCTGG + Intronic
1023749423 7:43357065-43357087 GGACAGGGAGCAACAAATGCTGG + Intronic
1023768371 7:43532639-43532661 GGAGAATGAGCATCACAAGCTGG - Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024055759 7:45659039-45659061 GGCCAGAGGGCAGCACAGGCAGG - Intronic
1024819816 7:53314978-53315000 GGACAGAGAGAACCCCAGGAAGG - Intergenic
1026571141 7:71532078-71532100 GTACTGGGAGCACCAGAAGCTGG + Intronic
1032186848 7:129734058-129734080 GGTCAGAGAGCTCCACAAGTGGG - Intronic
1032435045 7:131893805-131893827 GGGTAGAGAGCAGCCCAAGCTGG + Intergenic
1033601826 7:142894075-142894097 GGACAGAGAGACCCAGAAGCAGG + Intergenic
1034211234 7:149365036-149365058 AGGCAGAGTGCACCACAACCAGG + Intergenic
1034687219 7:152983334-152983356 GAACAGAGAGCACTAGAGGCTGG + Intergenic
1035361775 7:158318169-158318191 GGACAGGCCGCACCACAGGCGGG + Intronic
1036428770 8:8670333-8670355 GGACAGAGAGCACTAGGAGTAGG + Intergenic
1037145135 8:15562703-15562725 GAACTGAGAGCAACACAAGCAGG - Intronic
1038695113 8:29799481-29799503 GAACAGAGGGCATCCCAAGCAGG + Intergenic
1038854948 8:31320956-31320978 GGACAGAGAGGCAGACAAGCTGG + Intergenic
1039338097 8:36616492-36616514 GGACAGAGAATACTACAGGCTGG + Intergenic
1039444600 8:37621143-37621165 GGACAGAGGGCAGAAAAAGCAGG + Intergenic
1040278558 8:46026138-46026160 ACACGGAGAGCACCACAAACTGG - Intergenic
1041877281 8:62704461-62704483 GAACAGAGACCACAACAAACAGG - Intronic
1044891299 8:96838802-96838824 GGACAAAGAGCACCAGGAACCGG - Intronic
1045667297 8:104502446-104502468 GAAAGGAGAGAACCACAAGCTGG - Intronic
1046634029 8:116652097-116652119 GGACAGAGATGAGCACAAGAGGG + Intronic
1049401416 8:142429183-142429205 TGACCAAGAGCACCACATGCGGG + Intergenic
1049738168 8:144221136-144221158 GGTCACAGAGCATCACAACCAGG + Intronic
1049892359 9:82579-82601 GGACAGAGAAAAGCACAAGGCGG + Intergenic
1051502612 9:17794402-17794424 GGACAGAGAGCACCACCTGCCGG - Intronic
1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG + Intergenic
1053733778 9:41083656-41083678 GGACAGAGAGAAGCACAAGGCGG + Intergenic
1054694631 9:68347896-68347918 GGACAGAGAGAAGCACAAGGCGG - Intronic
1055107178 9:72525327-72525349 GGACAAAGAGCAGCAGAGGCAGG - Intronic
1055927328 9:81523964-81523986 GGAAAGAGAGAACCCCAAACAGG - Intergenic
1056629115 9:88278116-88278138 GGACAGGCGGGACCACAAGCCGG - Intergenic
1058152773 9:101480421-101480443 GGGAATAGTGCACCACAAGCTGG + Intronic
1061360668 9:130140193-130140215 GGAGAGACAGCACCAGGAGCCGG - Intergenic
1062192846 9:135256538-135256560 GGACAGAGAGGACCCCAGGGAGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062639230 9:137509010-137509032 AGACAGAGAGCAGCACATGCTGG + Intronic
1185975744 X:4718401-4718423 GCACAGACAGCACGCCAAGCTGG + Intergenic
1186260976 X:7779131-7779153 GGTCAGAGAGCAACACAAAATGG + Intergenic
1189353435 X:40294248-40294270 AGACAGATAGCACCACAGGCAGG - Intergenic
1189682500 X:43531360-43531382 GGACTGAGAGCAGGACAAGTGGG - Intergenic
1190515494 X:51219910-51219932 GGGCAAAGAGCACTACAGGCAGG - Intergenic
1193468636 X:81874671-81874693 GGACCAGGTGCACCACAAGCAGG + Intergenic
1193986926 X:88253436-88253458 GGACAGAGAGCGCAACAAATGGG - Intergenic
1194978565 X:100416894-100416916 GCAGAGAGAGCACCACAAAGGGG + Intergenic
1195161295 X:102174385-102174407 GGACACAGATCTCCTCAAGCAGG + Intergenic
1195166127 X:102222457-102222479 GGACACAGATCTCCTCAAGCAGG + Exonic
1195192732 X:102464631-102464653 GGACACAGATCTCCTCAAGCAGG - Exonic
1195942305 X:110176288-110176310 GGGCAGGGAGGACCAGAAGCAGG - Exonic
1198597383 X:138251301-138251323 GGCCTCAGAGCTCCACAAGCAGG - Intergenic
1199879864 X:151965466-151965488 GAACAGCAAGTACCACAAGCAGG + Intronic
1200119454 X:153783497-153783519 GGACAGAGAGCACCCTGAGGCGG + Intronic
1201428857 Y:13885015-13885037 GGACAGGAAGCACCCCAACCTGG - Intergenic