ID: 1083923972

View in Genome Browser
Species Human (GRCh38)
Location 11:65794928-65794950
Sequence TAGGGCCAAGGGATGGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083923972_1083923983 8 Left 1083923972 11:65794928-65794950 CCTCCGTCCATCCCTTGGCCCTA 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1083923983 11:65794959-65794981 GGTCCTGTCCTTTCTGTGTCTGG 0: 1
1: 0
2: 1
3: 23
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083923972 Original CRISPR TAGGGCCAAGGGATGGACGG AGG (reversed) Intronic