ID: 1083925527

View in Genome Browser
Species Human (GRCh38)
Location 11:65803858-65803880
Sequence GGAGGAGTTCAGGGCATGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083925527_1083925535 11 Left 1083925527 11:65803858-65803880 CCCGACATGCCCTGAACTCCTCC No data
Right 1083925535 11:65803892-65803914 ATTTTCCAAAGTAATGATCTTGG No data
1083925527_1083925537 15 Left 1083925527 11:65803858-65803880 CCCGACATGCCCTGAACTCCTCC No data
Right 1083925537 11:65803896-65803918 TCCAAAGTAATGATCTTGGTGGG No data
1083925527_1083925536 14 Left 1083925527 11:65803858-65803880 CCCGACATGCCCTGAACTCCTCC No data
Right 1083925536 11:65803895-65803917 TTCCAAAGTAATGATCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083925527 Original CRISPR GGAGGAGTTCAGGGCATGTC GGG (reversed) Intergenic
No off target data available for this crispr