ID: 1083925633

View in Genome Browser
Species Human (GRCh38)
Location 11:65804328-65804350
Sequence CCCACAGAGGTCCCTACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083925633_1083925642 15 Left 1083925633 11:65804328-65804350 CCTTGTGTAGGGACCTCTGTGGG No data
Right 1083925642 11:65804366-65804388 AGGCCACAGCCCTGTAAGAGAGG No data
1083925633_1083925648 28 Left 1083925633 11:65804328-65804350 CCTTGTGTAGGGACCTCTGTGGG No data
Right 1083925648 11:65804379-65804401 GTAAGAGAGGTGGTAGGTGCTGG No data
1083925633_1083925645 22 Left 1083925633 11:65804328-65804350 CCTTGTGTAGGGACCTCTGTGGG No data
Right 1083925645 11:65804373-65804395 AGCCCTGTAAGAGAGGTGGTAGG No data
1083925633_1083925637 -5 Left 1083925633 11:65804328-65804350 CCTTGTGTAGGGACCTCTGTGGG No data
Right 1083925637 11:65804346-65804368 GTGGGGCCACCACAGCCCTCAGG No data
1083925633_1083925644 18 Left 1083925633 11:65804328-65804350 CCTTGTGTAGGGACCTCTGTGGG No data
Right 1083925644 11:65804369-65804391 CCACAGCCCTGTAAGAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083925633 Original CRISPR CCCACAGAGGTCCCTACACA AGG (reversed) Intergenic
No off target data available for this crispr