ID: 1083928807

View in Genome Browser
Species Human (GRCh38)
Location 11:65827057-65827079
Sequence TGGGATCCTGAATGGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083928807_1083928821 14 Left 1083928807 11:65827057-65827079 CCCTACCCCCATTCAGGATCCCA 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1083928821 11:65827094-65827116 AGGTGAGGAAGCCAAGGTTCAGG 0: 1
1: 2
2: 16
3: 127
4: 653
1083928807_1083928823 24 Left 1083928807 11:65827057-65827079 CCCTACCCCCATTCAGGATCCCA 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1083928823 11:65827104-65827126 GCCAAGGTTCAGGGCTTGTCTGG 0: 1
1: 0
2: 1
3: 10
4: 167
1083928807_1083928822 15 Left 1083928807 11:65827057-65827079 CCCTACCCCCATTCAGGATCCCA 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1083928822 11:65827095-65827117 GGTGAGGAAGCCAAGGTTCAGGG 0: 1
1: 0
2: 16
3: 102
4: 601
1083928807_1083928818 -1 Left 1083928807 11:65827057-65827079 CCCTACCCCCATTCAGGATCCCA 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1083928818 11:65827079-65827101 AGGCCTTGCTTTGGCAGGTGAGG 0: 1
1: 0
2: 1
3: 22
4: 309
1083928807_1083928825 28 Left 1083928807 11:65827057-65827079 CCCTACCCCCATTCAGGATCCCA 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1083928825 11:65827108-65827130 AGGTTCAGGGCTTGTCTGGTAGG 0: 1
1: 0
2: 2
3: 13
4: 174
1083928807_1083928814 -10 Left 1083928807 11:65827057-65827079 CCCTACCCCCATTCAGGATCCCA 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1083928814 11:65827070-65827092 CAGGATCCCAGGCCTTGCTTTGG 0: 1
1: 0
2: 0
3: 20
4: 236
1083928807_1083928815 -6 Left 1083928807 11:65827057-65827079 CCCTACCCCCATTCAGGATCCCA 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1083928815 11:65827074-65827096 ATCCCAGGCCTTGCTTTGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 223
1083928807_1083928820 8 Left 1083928807 11:65827057-65827079 CCCTACCCCCATTCAGGATCCCA 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1083928820 11:65827088-65827110 TTTGGCAGGTGAGGAAGCCAAGG 0: 1
1: 2
2: 19
3: 156
4: 1183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083928807 Original CRISPR TGGGATCCTGAATGGGGGTA GGG (reversed) Intronic
900954388 1:5877675-5877697 TCGGATCAGGAATGGGGGTAAGG + Intronic
903810344 1:26031593-26031615 TGGGATCCAGGGTGGGGGTAAGG + Intronic
907014187 1:50995271-50995293 TGGGATCCTGGATGGGATTATGG + Intergenic
908246343 1:62230235-62230257 GGGGATCCTGGATGGGGCTGAGG + Intergenic
908605345 1:65792421-65792443 TGGGATTATGAATGGGGGCTGGG + Intergenic
909471130 1:76029641-76029663 TGGCATCCTGAATGGGATTCTGG - Intergenic
910931833 1:92450483-92450505 TGGGTGTCTGCATGGGGGTAGGG - Intergenic
911139337 1:94481869-94481891 TGGGACCCTAAATGGGGTTGAGG + Intronic
911551939 1:99293025-99293047 TGGGGTCATGAGAGGGGGTAGGG + Intronic
912418812 1:109529963-109529985 TGGGATACTGGAAGGAGGTAGGG - Intergenic
915767748 1:158382935-158382957 TGGGGTCATGGATGGGGGAAAGG + Intergenic
916078635 1:161218224-161218246 TTGGATCTGGAATGGGGGAAAGG - Exonic
922352148 1:224742958-224742980 TAGTATCCTGAATGGAGGTCAGG + Intergenic
924875622 1:248100212-248100234 TGGGATTGAGCATGGGGGTAAGG - Exonic
1063018796 10:2105267-2105289 TGGGATCCTGAATGGGACCCTGG + Intergenic
1063664157 10:8051732-8051754 GGGGATCCTGGCCGGGGGTAAGG - Intergenic
1067664109 10:48258585-48258607 TGGAATCCTGAAGAGTGGTAGGG - Intronic
1069356462 10:67592187-67592209 AGGGGTCCTGAAAGTGGGTAAGG - Intronic
1069817519 10:71207849-71207871 TGGGATCCTGAATGGGATCCTGG + Intergenic
1072984357 10:100126953-100126975 TGGGAGCCTGATTGGGTGGATGG - Intergenic
1075590288 10:123686390-123686412 TGGGAGCCTGAATGGGGAAATGG - Intronic
1076799293 10:132813263-132813285 TGGGATCCTGTATGGAAGGAGGG - Intronic
1077483333 11:2826738-2826760 TGGGATTCTGAGTGGAGGCAGGG - Intronic
1083600820 11:63946504-63946526 TGGGATACTAAATGGAGGCAGGG - Intronic
1083928807 11:65827057-65827079 TGGGATCCTGAATGGGGGTAGGG - Intronic
1085112500 11:73900329-73900351 TGTGGTCCTGAGTGGGGGAATGG + Exonic
1086884317 11:92186967-92186989 TGGGATTTTGACTGGGGTTATGG - Intergenic
1088549655 11:110999614-110999636 TGGGATCCTGAATTGGATCATGG - Intergenic
1088969920 11:114764194-114764216 TGAGATCATAAATGGGGGTTTGG + Intergenic
1091096880 11:132831682-132831704 GGGGATGCTGAATGGGGGAGAGG - Intronic
1091348183 11:134870021-134870043 TGGGATCTTGAAACGGGGGAGGG - Intergenic
1091857834 12:3753323-3753345 TGGGAGCCTGAATCGGGGCAAGG - Intronic
1093013148 12:14129437-14129459 TGAGAACCTGACTGGGGGGAAGG + Intergenic
1093288382 12:17294683-17294705 TGGGATTCCAAATGAGGGTAGGG - Intergenic
1094720825 12:33062181-33062203 TGGGATCCTGAATCAGGAAAAGG + Intergenic
1095270698 12:40215259-40215281 TGGCAGCCTGAATGGGGCCATGG - Intronic
1098160932 12:67648272-67648294 TGGGACCAAGAATGGGGGGACGG + Intergenic
1101599513 12:106196876-106196898 TGGAATCCTAAATGGGGTAAAGG + Intergenic
1102010699 12:109616728-109616750 TGGGATACTGACTGGGGCTTGGG - Intergenic
1102084285 12:110123654-110123676 TGAGAGCCTGAAAGGGGGTGTGG - Intergenic
1103615359 12:122148372-122148394 TGGGATCCTAAAAGATGGTAGGG + Intergenic
1106872708 13:34038949-34038971 TGAGAACCTGAGTGGGGGTGGGG - Intergenic
1107002398 13:35564421-35564443 TGGGATCCTAAATGGGTCCATGG - Intronic
1107793129 13:44022689-44022711 TGGGAGCCTGAGTGGGAGTTGGG + Intergenic
1114413950 14:22526547-22526569 TGGGCCCCTGAATGAGGTTATGG + Intergenic
1119072285 14:71598646-71598668 TGGGATTCTGAATGGGATTGGGG + Intronic
1122835556 14:104429168-104429190 TGGGATCCTGGATGGGGTCTTGG - Intergenic
1126056677 15:44736255-44736277 TGGGATCATGAACAGGGGTGAGG + Intronic
1126629218 15:50717003-50717025 TGGGAAACTGAGTGGGGGGATGG - Intronic
1127805150 15:62512389-62512411 TGTTATCCAGAATGGGGGAAAGG - Intronic
1127815465 15:62604911-62604933 TGGGTTTCTTAATGGGGGAAAGG - Intronic
1129107027 15:73317688-73317710 CGGGGGCCTGAATTGGGGTAGGG + Intergenic
1129936345 15:79453351-79453373 GGGGGTCCTGTATGGGGTTAGGG - Intronic
1131224354 15:90611648-90611670 TCGGCTACTGAATGGGCGTAGGG - Intronic
1131803668 15:96099269-96099291 CTGGATCCTGAAAGGAGGTAAGG - Intergenic
1132846064 16:2001461-2001483 TGGGGTCCTGAGTGGCAGTAGGG - Intronic
1133793404 16:9027070-9027092 ATGGTTCCTGAATGGGGCTATGG - Intergenic
1135746888 16:25024922-25024944 TGGGATACAGGAAGGGGGTATGG - Intergenic
1138319311 16:56098408-56098430 TGGGATCCTGAGTTGGGCGATGG + Intergenic
1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG + Intergenic
1146172746 17:30646079-30646101 TGGGATACAGGATGGGGGTAGGG - Intergenic
1146346202 17:32062088-32062110 TGGGATACAGGATGGGGGTAGGG - Intergenic
1146637117 17:34514708-34514730 TGGGATCCCGAAAGGGGATAAGG - Intergenic
1146721113 17:35124142-35124164 TGGGAGGCTGGATGGGAGTAAGG + Intronic
1147862706 17:43533023-43533045 TGGGCTCCGGAATGGGGGGTAGG + Intronic
1148053597 17:44780851-44780873 TCGGCTCTGGAATGGGGGTAGGG - Exonic
1148876346 17:50689723-50689745 TGGGGTCCTAAATGGGAGTGGGG - Intronic
1149253284 17:54794773-54794795 TGGGAGCTTGCATGGGGGCAGGG - Intergenic
1152294248 17:79457380-79457402 ATGGCTCATGAATGGGGGTACGG + Intronic
1153533458 18:6074198-6074220 TAGAATCTTGAATGGAGGTAGGG + Intronic
1154172878 18:12063634-12063656 TGGGATTCAGATTGGGGGTGGGG - Intergenic
1158208003 18:55015071-55015093 TGGGCTCCTCAATCAGGGTAGGG + Intergenic
1160993131 19:1869075-1869097 TGGGACCCTGGATGGGGGCCGGG + Intergenic
1161144252 19:2667980-2668002 TGGGATCCTGGATGGGGCCCTGG + Intronic
1161335980 19:3713500-3713522 TGGGATCCTGGATGGGGCCCTGG + Intronic
1161369193 19:3900427-3900449 TGGGATCCTGGATGGGGTTGTGG - Intronic
1162989685 19:14294008-14294030 TGGGATACAGAATGGGGGTAGGG + Intergenic
1163438532 19:17309863-17309885 TGGTATCCTGGATGGGGTCAGGG - Intronic
1163493168 19:17629185-17629207 GGGGATGCTGAATGGGGCTGAGG + Intronic
1163611729 19:18305211-18305233 TGGGACCCTGAATGGTGAGAAGG + Intergenic
1165176577 19:33934841-33934863 TGTGATTCTGAGTGGGGCTAGGG + Intergenic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1165490490 19:36120499-36120521 TGGGAGCTTGGATGGGGGTGAGG + Intronic
1166315187 19:41985578-41985600 TGGGATCTTGAAGGTGGGGAAGG + Intronic
1167422709 19:49413515-49413537 TGGGAGCCTGAAAGAGGGGAGGG - Intronic
927184521 2:20472834-20472856 TGGGAGCCTGCAGGGTGGTAGGG + Intergenic
928407008 2:31022490-31022512 TGGGATTCTGACTTGGGGAAAGG - Intronic
928746801 2:34425367-34425389 GGGGATCCTGGATTTGGGTAGGG - Intergenic
929864909 2:45709568-45709590 TGGAATCCAGAATGGGGATGGGG - Intronic
933745099 2:85564846-85564868 GGGGAGCCTGAAGGGGGATATGG + Intronic
934552732 2:95272003-95272025 TGGGATCCTGCTGGGGGGAAGGG + Intergenic
937091514 2:119209462-119209484 TGGGATCCCGAATAAGGGAAAGG + Intergenic
937902328 2:127030231-127030253 TGGGATCCTGGATGGGGTCCTGG + Intergenic
938148336 2:128858506-128858528 TGGAGTCCCTAATGGGGGTAGGG - Intergenic
938541884 2:132289802-132289824 TGGGGCCCTGCATGGGGGGAGGG - Intergenic
939356413 2:141108942-141108964 TGGGAACCTGAATTGTGCTAAGG + Intronic
939955188 2:148521881-148521903 GGGGATCCTGAAGGGGGTGAAGG + Intergenic
941878513 2:170459541-170459563 TGGGCTCCTGGGTGGGGGTGGGG - Intronic
942458828 2:176155807-176155829 TGGGGTCCTGACTGGGGGAGGGG + Intronic
942486260 2:176442978-176443000 TGGGATCCGTAATGGAGGTGGGG + Intergenic
943872937 2:193025214-193025236 AGGGACCCTGAATGGAGGGACGG + Intergenic
946328695 2:218997840-218997862 TGGGCTCCAGACTGGGGGTGGGG - Intergenic
947196679 2:227574721-227574743 TGGAAGCCTGAAAGGGGGTGGGG - Intergenic
1168855595 20:1005515-1005537 TGGGCACCTGTATTGGGGTAGGG - Intergenic
1171180738 20:23088738-23088760 TGGCATCCTGACTGGGGGATGGG + Intergenic
1171192671 20:23170296-23170318 TGGGAACCTGAGAGGGAGTAGGG + Intergenic
1171870763 20:30522683-30522705 TGGGGCCCTGCATGGGGGGAGGG - Intergenic
1171954950 20:31454594-31454616 TAGGATCCTGGATGGGGATGTGG + Intergenic
1173662517 20:44744493-44744515 GGGGCTCCTGATTGGGGGTTGGG + Intergenic
1174934465 20:54852372-54852394 TGGGCTCTTGGATGGGGGAATGG - Intergenic
1178737639 21:35167156-35167178 TGGGTTCATGAATGAGTGTAGGG + Intronic
1179282426 21:39945276-39945298 TGGGATCTTGGATGGGGGAGGGG + Intergenic
1179598962 21:42462702-42462724 TGGGATCCTGACTGAGAGGATGG + Intergenic
1181006290 22:20015259-20015281 TGGACCCCAGAATGGGGGTAGGG + Intronic
1181330773 22:22088988-22089010 TGGGATCCTGTATGAGGATGAGG + Intergenic
1181439855 22:22930200-22930222 TGGGGACCTGGATGGGGCTAAGG - Intergenic
1182142011 22:27967661-27967683 TGGGAGCCTGAGTGGGGTGACGG - Intergenic
1182321194 22:29479514-29479536 GGCTACCCTGAATGGGGGTATGG - Intergenic
1183030959 22:35104131-35104153 TGGGAACCTGGTTGGGGGTGGGG + Intergenic
1184653943 22:45931898-45931920 TGGGTTCCTGGCTGGGGGTGGGG - Intronic
1185177044 22:49333860-49333882 TGGGAGCCCGGATGGGGGCATGG + Intergenic
1185209850 22:49564730-49564752 TGGGCTCCTGAATCGGGGCCAGG - Intronic
949335938 3:2975871-2975893 TGTGAGGATGAATGGGGGTAAGG - Intronic
951621516 3:24606753-24606775 TGGGACCTTGGATGGGGGCAGGG + Intergenic
959545913 3:107596253-107596275 TGGGGGCAGGAATGGGGGTAGGG + Intronic
959674992 3:109024735-109024757 TGTGATACTGAATGGGTGAATGG + Intronic
960047293 3:113210946-113210968 TGGGATGATGAATGGAGGTCAGG + Intergenic
961138400 3:124534176-124534198 TGGAATCCTGAATGGGATTCTGG + Intronic
961513659 3:127419867-127419889 AGGGATCCTCCATGGGGGTTTGG - Intergenic
963924583 3:150938101-150938123 AGGGAACCTGAATGTGAGTAGGG + Intronic
964238399 3:154561982-154562004 TGGGATGCTGGATTGGGTTAGGG - Intergenic
966231220 3:177654462-177654484 TGGCATCCTGAATGGGATTCTGG - Intergenic
966588466 3:181653226-181653248 TGGGGTCTTGGATGGGGGTGGGG + Intergenic
968393890 4:215302-215324 TGTGATCCTGGTTGGGTGTATGG - Intergenic
968401446 4:301928-301950 TGTGATCCTGATTGGGATTATGG + Intronic
968663837 4:1810185-1810207 TGGGATCCTGAATGGGTGCTGGG + Intergenic
969708737 4:8830778-8830800 TGGGACGTTGGATGGGGGTAGGG - Intergenic
972595330 4:40525015-40525037 TATGATCCAGTATGGGGGTAAGG + Intronic
975641701 4:76506892-76506914 TGGGATCATAAATGGGGGAAAGG - Intronic
977340808 4:95754941-95754963 TGCTATCCTGAATGGGGTCAAGG + Intergenic
978163726 4:105581126-105581148 GGGAATCCTGTATGGGGCTACGG - Intronic
980604050 4:135066030-135066052 AGGGATCCTGGATTGGGGTGGGG + Intergenic
980700893 4:136428691-136428713 TAGGATAAGGAATGGGGGTAGGG - Intergenic
981503934 4:145480252-145480274 TTGGATCCTGAATGGGGAGGAGG - Intergenic
983050912 4:163047002-163047024 TTAAAGCCTGAATGGGGGTAGGG + Intergenic
986585246 5:9309602-9309624 TGGGATCCTGAACGGCAGCATGG + Intronic
990965139 5:61438129-61438151 TGAGCTACTGAATGGGGGGAAGG - Intronic
991288460 5:65007347-65007369 TGGTATCCTGAATGGGATTCAGG + Intronic
992275812 5:75117097-75117119 GGGAATCCAGAATGGGAGTAGGG - Intronic
997974300 5:138430427-138430449 TGGGTTCCTGCTTGGGGGTTGGG + Intronic
998364738 5:141622105-141622127 TGAGATCCTGGATGTAGGTAAGG + Intronic
998583038 5:143401027-143401049 TGGCATGCTGAATGGGAGCAGGG - Intronic
1000153235 5:158524262-158524284 TGGGAACTTTAATGGGGGAATGG + Intergenic
1001879907 5:175234361-175234383 TAGGATCCTGAAGGTGGGAAGGG - Intergenic
1003666068 6:8112495-8112517 TGGGAGCCTGAAGGGGGTTTGGG - Intergenic
1004776120 6:18846911-18846933 AGTGGTCCTAAATGGGGGTATGG - Intergenic
1005557918 6:27007141-27007163 TGGGAGCCTGAATAGGTGTGTGG + Intergenic
1007815608 6:44522978-44523000 GGGGATCCTGGATGGAGCTATGG + Intergenic
1013984503 6:116173908-116173930 TGGTATCCTGAATGGGATTATGG - Intronic
1014172650 6:118296028-118296050 TGGGTTCCTGAATGGCTGCATGG - Intronic
1015834853 6:137409280-137409302 TTGGGTCCTGAATGGTGGAAGGG - Intergenic
1016282657 6:142436103-142436125 TGGAATCCTGGTGGGGGGTAGGG + Intronic
1018461343 6:164002225-164002247 AAGGATCCTGAAGGAGGGTAGGG + Intergenic
1019842061 7:3457037-3457059 TGGGAACTTTAATGGGGGAAGGG + Intronic
1020772096 7:12407305-12407327 TGTGATCCTGAACTGGAGTAAGG + Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1032521844 7:132551322-132551344 TGGGCTCCTGAATGACTGTATGG + Intronic
1033340776 7:140490644-140490666 TGGGAGACTGAAGGGGGGTGGGG - Intergenic
1033643715 7:143285624-143285646 CCGGATCCTGGATGGTGGTAAGG + Intronic
1033808524 7:144982193-144982215 TGGGATCCTGAATGGGATCTTGG - Intergenic
1038723832 8:30061441-30061463 TGGGATCCTGAAAAGTGGAATGG - Intergenic
1041895233 8:62916940-62916962 AGGGATCCTAAAGGGGGGTGGGG - Intronic
1044590259 8:93907495-93907517 TGAGATCCAGAAAGGGGGTGAGG - Intronic
1045807242 8:106177975-106177997 TGGGAGCTAGAATGGCGGTAGGG - Intergenic
1045976075 8:108131716-108131738 TGGGATGCTGAAAGGGGGCCTGG + Intergenic
1049483576 8:142839650-142839672 CGGGCTGCTGAAGGGGGGTAGGG + Intronic
1051789358 9:20783062-20783084 TTGGATCTTGAATGGGAGTGGGG + Intronic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1057301687 9:93889635-93889657 TGGGATACTGGATGGGGTTCTGG + Intergenic
1057970953 9:99556971-99556993 TGGGACCTTGAATGGGAGTGTGG + Intergenic
1059046199 9:110870306-110870328 TAGGAGTCAGAATGGGGGTAAGG + Intergenic
1060357652 9:122925265-122925287 TGGGAGGCTGAATGGGAGGATGG + Intronic
1061013082 9:127966890-127966912 TGGGTTCCTGAAGGGGGGCCTGG - Intronic
1185973488 X:4691592-4691614 TGGGTTCCTGAATGCTGGTATGG + Intergenic
1186499596 X:10040738-10040760 TGGGCTCCTGGATGGGGGCTGGG - Intronic
1189227687 X:39427070-39427092 TGGAATCCTCATTGGGGGAATGG + Intergenic
1189372186 X:40437653-40437675 TGGGATCCTGAAAGTTGGAATGG + Intergenic
1191677729 X:63809386-63809408 TTGGAGCCTGAAAGGGGGAAAGG - Intergenic
1192341728 X:70268634-70268656 TGGGGACCTGGATGGGGATAAGG + Intronic
1193321087 X:80122346-80122368 TGTGATGTTGTATGGGGGTAGGG + Intergenic
1194524305 X:94959016-94959038 TGGGAGTGTGAATGGGGGTGGGG - Intergenic
1195217193 X:102713254-102713276 TGGGGACCCGAATCGGGGTAGGG + Intronic
1196179025 X:112670391-112670413 GGGGAGCCTGAATGAGGGGAAGG + Intronic
1197755043 X:129987508-129987530 AAGGATACTGAATGGGGGGAGGG + Intronic
1198104427 X:133448770-133448792 TGGCATCCTGAATGAGGTTTTGG - Intergenic
1200182401 X:154158717-154158739 TGGGATTCGGAATGGGTGAAGGG + Intronic
1200188055 X:154195831-154195853 TGGGATTCGGAATGGGTGAAGGG + Intergenic
1200193705 X:154232971-154232993 TGGGATTCGGAATGGGTGAAGGG + Intronic
1200199460 X:154270775-154270797 TGGGATTCGGAATGGGTGAAGGG + Intronic
1200867016 Y:8055634-8055656 TGGGGTCCTGGGAGGGGGTAGGG - Intergenic