ID: 1083929756

View in Genome Browser
Species Human (GRCh38)
Location 11:65834155-65834177
Sequence CGTGATGCCCAATCATGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083929745_1083929756 6 Left 1083929745 11:65834126-65834148 CCCCAGCCTCCCCTCACTCCATG 0: 1
1: 0
2: 11
3: 95
4: 899
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1083929746_1083929756 5 Left 1083929746 11:65834127-65834149 CCCAGCCTCCCCTCACTCCATGA 0: 1
1: 0
2: 4
3: 38
4: 427
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1083929751_1083929756 -5 Left 1083929751 11:65834137-65834159 CCTCACTCCATGAAAGCCCGTGA 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1083929747_1083929756 4 Left 1083929747 11:65834128-65834150 CCAGCCTCCCCTCACTCCATGAA 0: 1
1: 0
2: 5
3: 76
4: 774
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1083929744_1083929756 9 Left 1083929744 11:65834123-65834145 CCACCCCAGCCTCCCCTCACTCC 0: 1
1: 0
2: 37
3: 309
4: 2184
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1083929750_1083929756 -4 Left 1083929750 11:65834136-65834158 CCCTCACTCCATGAAAGCCCGTG 0: 1
1: 0
2: 0
3: 13
4: 114
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1083929748_1083929756 0 Left 1083929748 11:65834132-65834154 CCTCCCCTCACTCCATGAAAGCC 0: 1
1: 0
2: 1
3: 79
4: 707
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1083929743_1083929756 10 Left 1083929743 11:65834122-65834144 CCCACCCCAGCCTCCCCTCACTC 0: 1
1: 0
2: 8
3: 175
4: 1511
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1083929749_1083929756 -3 Left 1083929749 11:65834135-65834157 CCCCTCACTCCATGAAAGCCCGT 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1083929742_1083929756 11 Left 1083929742 11:65834121-65834143 CCCCACCCCAGCCTCCCCTCACT 0: 1
1: 1
2: 17
3: 177
4: 1791
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22
1083929741_1083929756 12 Left 1083929741 11:65834120-65834142 CCCCCACCCCAGCCTCCCCTCAC 0: 1
1: 3
2: 25
3: 271
4: 2115
Right 1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083929756 Original CRISPR CGTGATGCCCAATCATGCGG TGG Intronic
904915364 1:33966367-33966389 CGTAATTCCCAATTATGCTGAGG + Intronic
905294195 1:36943859-36943881 CGTGCTGCCCAACCATGAGCTGG + Intronic
914987865 1:152475498-152475520 AGTGATGCCCTAACAGGCGGAGG + Intergenic
924492254 1:244549897-244549919 CGTGATGCCCAACCACACTGGGG - Intronic
1071499515 10:86193490-86193512 CATGATGGCCAATCATCCAGGGG + Intronic
1079450861 11:20598696-20598718 CGGGATGCCCAGCAATGCGGGGG - Intergenic
1083929756 11:65834155-65834177 CGTGATGCCCAATCATGCGGTGG + Intronic
1089345178 11:117786501-117786523 CCTGATGCCCAAGCAAGCGGTGG - Intronic
1116765903 14:49070394-49070416 CCTGATGCCCTATCCTGCTGTGG - Intergenic
1131838756 15:96415356-96415378 TGTGATGTGCAATCCTGCGGAGG - Intergenic
1140442435 16:74998607-74998629 CGTGATGTCCATTCTTTCGGGGG - Intronic
1141915879 16:87096722-87096744 AGCGATGCCCAATCGTGCAGCGG + Intronic
1151504090 17:74515001-74515023 CGTGATGGGCAATCATGTGATGG + Intergenic
1159921828 18:74233456-74233478 TGTGATGAGCAGTCATGCGGTGG - Intergenic
925008965 2:467891-467913 CGTGATTCCCACTCACGCCGGGG + Intergenic
1184348907 22:43930431-43930453 GCTGATGCCCAACCATGCTGTGG - Intronic
1184759195 22:46535400-46535422 CGTGGTGCACATTCAGGCGGTGG - Exonic
954041280 3:47889330-47889352 TGGGATGCCAAATAATGCGGAGG - Intronic
1000383190 5:160647418-160647440 CATGAGGCCCAGTCATGTGGAGG + Intronic
1026275036 7:68869231-68869253 CGTGCTGCCCTGTCATGGGGTGG - Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1040001597 8:42581596-42581618 ACTGGTGCCCAATCATGGGGTGG + Intergenic
1186472082 X:9829500-9829522 AATGATGCCCAATCATGATGGGG + Intronic
1187320093 X:18230226-18230248 CGCCATGCACAATCATGAGGCGG + Intergenic