ID: 1083931101

View in Genome Browser
Species Human (GRCh38)
Location 11:65846022-65846044
Sequence AGTTCTATGGGAGGCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230492
Summary {0: 2, 1: 47, 2: 3042, 3: 67285, 4: 160116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083931092_1083931101 17 Left 1083931092 11:65845982-65846004 CCAGCATAGGCTGGGCTCAGTGG 0: 1
1: 1
2: 26
3: 164
4: 872
Right 1083931101 11:65846022-65846044 AGTTCTATGGGAGGCCAAGGTGG 0: 2
1: 47
2: 3042
3: 67285
4: 160116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083931101 Original CRISPR AGTTCTATGGGAGGCCAAGG TGG Intronic
Too many off-targets to display for this crispr