ID: 1083933241

View in Genome Browser
Species Human (GRCh38)
Location 11:65857421-65857443
Sequence CTGCGTTCTCACCCGTGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083933241_1083933243 2 Left 1083933241 11:65857421-65857443 CCGATGCACGGGTGAGAACGCAG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1083933243 11:65857446-65857468 CGTTAGATGCGCTCCCGAACGGG 0: 1
1: 0
2: 0
3: 0
4: 5
1083933241_1083933242 1 Left 1083933241 11:65857421-65857443 CCGATGCACGGGTGAGAACGCAG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1083933242 11:65857445-65857467 TCGTTAGATGCGCTCCCGAACGG 0: 1
1: 0
2: 0
3: 0
4: 7
1083933241_1083933244 8 Left 1083933241 11:65857421-65857443 CCGATGCACGGGTGAGAACGCAG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1083933244 11:65857452-65857474 ATGCGCTCCCGAACGGGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083933241 Original CRISPR CTGCGTTCTCACCCGTGCAT CGG (reversed) Intronic
903325547 1:22566832-22566854 CTGCGTTCTCACCCATTCAAGGG + Intronic
907304100 1:53504317-53504339 CTGGGTTCAAACCCGGGCATCGG - Intergenic
1065311898 10:24424375-24424397 CTGTGTTCTAACCCCTGCAGTGG - Intronic
1073427321 10:103463309-103463331 CAGCGTTCTCATCCGTGAAATGG + Intergenic
1076353165 10:129832526-129832548 CACCTTTCTCACCCCTGCATGGG - Intergenic
1083933241 11:65857421-65857443 CTGCGTTCTCACCCGTGCATCGG - Intronic
1091683737 12:2546577-2546599 CTTCGTGCTCTCCCGTGCAGTGG + Intronic
1104371729 12:128229339-128229361 ATGTGTTCTCCCACGTGCATGGG + Intergenic
1106126134 13:26901370-26901392 CTGCGTTCTTCCCCGTGTGTTGG - Intergenic
1110543973 13:76736346-76736368 CTTCTTTCTCACCCTTGCCTTGG - Intergenic
1119881850 14:78105947-78105969 CGGTGTTCACACCTGTGCATTGG + Intergenic
1122393418 14:101406464-101406486 CTGTGTTCTCACCTGTGAAAGGG - Intergenic
1124192604 15:27593561-27593583 CTGCCTGCTCACGCGTGCTTGGG - Intergenic
1132886006 16:2182313-2182335 CTGCGCTCCCAGCCGTGCACAGG + Intronic
1134402703 16:13924664-13924686 CAGCTTACTCACCCGTACATTGG + Intronic
1137554321 16:49461139-49461161 CTGCCTTCTCACCCCTGCACAGG + Intergenic
1140500617 16:75430749-75430771 CTGTGTTCTCAGCCGAGCAGTGG - Intronic
1141094901 16:81156139-81156161 CTGCATGCTCACCTTTGCATCGG + Intergenic
1143973878 17:10815669-10815691 CTTCCCTCTTACCCGTGCATAGG + Intergenic
1148619419 17:49023004-49023026 CTGCGTTCTCAACCTTCCAATGG + Intronic
1150439864 17:65182414-65182436 CTGCTTTCTCAACCGTGAAACGG - Intronic
1152747877 17:82049575-82049597 CTGCCTGCTCAGCCGGGCATCGG + Intronic
1157803131 18:50637044-50637066 CAGTGTTCTCACCAGTGCTTTGG - Intronic
1160220339 18:76972393-76972415 CTATGTGCTCATCCGTGCATGGG - Intergenic
1166539522 19:43595993-43596015 CTGCGCTCTCTCCCGTGGGTCGG - Exonic
939100423 2:137889310-137889332 TTGCGGCCTCACCCTTGCATTGG + Intergenic
948553824 2:238793956-238793978 CTGCGTTCTCACCCGTGACATGG - Intergenic
1171377744 20:24705112-24705134 CGGCGTTCTCACCCTTGTGTAGG - Intergenic
1172816878 20:37694180-37694202 CCGCGTTCTCACCTGGGCAGGGG + Intronic
1178537913 21:33425436-33425458 CTGTGTTTTCAGCCGTGCAGTGG + Intronic
1184272410 22:43392395-43392417 CTCCGTTCCCTCCAGTGCATGGG + Intergenic
950124603 3:10503708-10503730 CTGCGTGCCTGCCCGTGCATTGG - Intronic
954793686 3:53150528-53150550 CTGAGTTTCCACCCCTGCATCGG + Intergenic
966425948 3:179779580-179779602 CTGCGCCCTCACACGTTCATGGG + Intronic
971947992 4:33306164-33306186 CTGCCTTTTCACAAGTGCATAGG - Intergenic
977306453 4:95329028-95329050 CTCCTCTCTCACCAGTGCATTGG + Intronic
980714735 4:136614760-136614782 CTGGGTTCTCACCCTTGCAAAGG + Intergenic
985731267 5:1550336-1550358 CTGCGTTCTCACCTGGGAAGAGG - Intergenic
989133998 5:38135419-38135441 TTACCTTCTCACCCTTGCATAGG + Intergenic
991066971 5:62434183-62434205 CTGCCTTCTGATCCTTGCATGGG + Intronic
1002080722 5:176735946-176735968 CAGCGTTCTCATCCGTGGAGTGG + Intergenic
1014735624 6:125092952-125092974 CTGCTTTCCCACCCCTGTATAGG - Intergenic
1018358854 6:163045260-163045282 CTGCCTTCTCACCTGTAGATAGG + Intronic
1024033394 7:45484305-45484327 CTGCCTGCTCACCCCTGCAGAGG + Intergenic
1029112665 7:98221782-98221804 CTGCCTTCTCCTCCTTGCATGGG + Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035368912 7:158366359-158366381 GTGCGTTTGCACGCGTGCATTGG - Intronic
1039893038 8:41697269-41697291 CTGCCTCCTCACCTGTGCAACGG + Intronic
1044611959 8:94100264-94100286 CTGAGTTCTCACCCGGGTAGGGG - Intergenic
1047900538 8:129416820-129416842 CTGCCATCTCCCCAGTGCATAGG - Intergenic
1048937209 8:139367256-139367278 CTCCCTTCTCTCCCGTCCATGGG + Intergenic
1049347215 8:142145440-142145462 CTGCCTGCCCACCTGTGCATTGG - Intergenic
1053063997 9:35054051-35054073 ATACGTTCTCACTCGTACATGGG + Intergenic
1059390628 9:113997661-113997683 CTGCTTCCTCACCCATGCAGTGG + Intronic
1061386041 9:130289881-130289903 CTGTGTTCTCATCTGTGCCTCGG + Intronic
1195939548 X:110156747-110156769 CTGTGTTCTCACACGTGGAAGGG + Intronic
1199715813 X:150506682-150506704 CTGCTTTCTCACCACTGCATGGG - Intronic