ID: 1083933287

View in Genome Browser
Species Human (GRCh38)
Location 11:65857607-65857629
Sequence CCGTCTCGGGAGCAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 128}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083933287_1083933297 -3 Left 1083933287 11:65857607-65857629 CCTGCCACCTGCTCCCGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1083933297 11:65857627-65857649 CGGACCCGGCTGCCGAGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 127
1083933287_1083933303 24 Left 1083933287 11:65857607-65857629 CCTGCCACCTGCTCCCGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1083933303 11:65857654-65857676 GCGCAGACAGGAACAGCCTTGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1083933287_1083933306 29 Left 1083933287 11:65857607-65857629 CCTGCCACCTGCTCCCGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1083933306 11:65857659-65857681 GACAGGAACAGCCTTGGGTGGGG 0: 1
1: 0
2: 0
3: 36
4: 246
1083933287_1083933295 -7 Left 1083933287 11:65857607-65857629 CCTGCCACCTGCTCCCGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1083933295 11:65857623-65857645 GAGACGGACCCGGCTGCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1083933287_1083933302 23 Left 1083933287 11:65857607-65857629 CCTGCCACCTGCTCCCGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1083933302 11:65857653-65857675 CGCGCAGACAGGAACAGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 92
1083933287_1083933305 28 Left 1083933287 11:65857607-65857629 CCTGCCACCTGCTCCCGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1083933305 11:65857658-65857680 AGACAGGAACAGCCTTGGGTGGG 0: 1
1: 0
2: 2
3: 25
4: 232
1083933287_1083933304 27 Left 1083933287 11:65857607-65857629 CCTGCCACCTGCTCCCGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1083933304 11:65857657-65857679 CAGACAGGAACAGCCTTGGGTGG 0: 1
1: 0
2: 2
3: 34
4: 234
1083933287_1083933296 -4 Left 1083933287 11:65857607-65857629 CCTGCCACCTGCTCCCGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1083933296 11:65857626-65857648 ACGGACCCGGCTGCCGAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1083933287_1083933301 12 Left 1083933287 11:65857607-65857629 CCTGCCACCTGCTCCCGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1083933301 11:65857642-65857664 AGGGAGGGTGACGCGCAGACAGG 0: 1
1: 0
2: 2
3: 5
4: 165
1083933287_1083933294 -8 Left 1083933287 11:65857607-65857629 CCTGCCACCTGCTCCCGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1083933294 11:65857622-65857644 CGAGACGGACCCGGCTGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083933287 Original CRISPR CCGTCTCGGGAGCAGGTGGC AGG (reversed) Intronic
900394061 1:2446005-2446027 CCATCACTGGAGCAGGTGGCAGG - Intronic
900409129 1:2504929-2504951 CCGGCTGGGGAGGGGGTGGCAGG + Exonic
901066652 1:6497469-6497491 CCGCCTCGGGGGCGGGGGGCGGG + Intronic
902841556 1:19077407-19077429 CAGGCTCGGGAGCAGGTGACAGG + Intronic
903788405 1:25875975-25875997 TGGCCTCGGGAGCAGGGGGCGGG - Intergenic
913518161 1:119622660-119622682 CCGTCTGGGGAGCCTGTGGGGGG - Exonic
913531539 1:119737406-119737428 CACTCTCCGGAGCAGGTGGGCGG + Intronic
915315470 1:155026294-155026316 CCATCCCGGGAGCAGGTGAGGGG - Exonic
920451710 1:206064636-206064658 CCGTCCCGGGGGGAGGTGGGGGG + Intronic
1064097214 10:12432851-12432873 CCATCTTGGGAGCAGGTGGGTGG - Intronic
1064109064 10:12522922-12522944 CCGTCTGGGAGGCAGGTGGGGGG - Intronic
1064194595 10:13234639-13234661 ACGTCCCTGGAGCAGGTGCCAGG - Intergenic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1067738494 10:48877756-48877778 CAGGCTGGGGACCAGGTGGCAGG + Intronic
1071292121 10:84195599-84195621 ACCTATCGGGAGCAGGTGCCAGG - Intronic
1073100457 10:101003810-101003832 CCGCCTGGGGAGCTGGTGGTTGG - Exonic
1076035722 10:127196869-127196891 CCGCCTCCGGAGCAGCTGGCGGG + Intronic
1077119509 11:900348-900370 CCGTGTGGGGAGCTGGTGTCAGG - Intronic
1079236378 11:18693547-18693569 CTGCCTCTGGAACAGGTGGCAGG - Intronic
1079251976 11:18793167-18793189 CCGTCTCGGGGGCGGGGGGGTGG - Intergenic
1080860180 11:36144963-36144985 CCGTCCCGGAAGGAGGTGGGGGG + Intronic
1081930555 11:46867982-46868004 ACGTCTCTGGAGGAGGTGGAAGG - Exonic
1083872639 11:65498532-65498554 CTGTCTTGGGAGCAAGTCGCAGG + Intergenic
1083933287 11:65857607-65857629 CCGTCTCGGGAGCAGGTGGCAGG - Intronic
1084192403 11:67505017-67505039 CAGTCTGGGGCGCAGGTGGACGG - Intronic
1084576686 11:69993136-69993158 CTGTCTCAGGAGGGGGTGGCTGG - Intergenic
1087189001 11:95232342-95232364 CTCACTCGGGAGCAGGTTGCGGG - Intronic
1089292296 11:117444545-117444567 CCGTCCAGGGAGGAGGGGGCGGG + Intronic
1090756765 11:129798546-129798568 CCTTCTCTGGTGGAGGTGGCAGG - Intergenic
1091305774 11:134535289-134535311 ATGTCTTGGGAGCAGGTGTCAGG - Intergenic
1095725453 12:45446841-45446863 CCGGCTCTGGTGGAGGTGGCAGG - Intergenic
1096214873 12:49793257-49793279 CCGTCCCCGCAGCAGGTGCCAGG - Intronic
1102186303 12:110950951-110950973 CCGTCTGGGAGGCAGGTGGGGGG - Intergenic
1102280739 12:111616845-111616867 CCTACTCGGGAGCATGAGGCAGG + Intergenic
1102929129 12:116849239-116849261 CGGTCTCGGGAGCAGGAGAAGGG - Intronic
1104901081 12:132189828-132189850 CCGTCTCGGGGGCAGGTCCGCGG + Intergenic
1113335091 13:109369872-109369894 CCCTCTTGGGTGCAGGTGCCTGG - Intergenic
1121120934 14:91375560-91375582 CTGCCTCGTGAGCAGGTGCCGGG - Intronic
1123160177 14:106270853-106270875 CCGTCTCGGGAGGAAGAGGTTGG - Intergenic
1125834261 15:42736501-42736523 CCGCCGCGGGGGCAGGAGGCGGG - Exonic
1127795690 15:62436472-62436494 GCCTTTCGTGAGCAGGTGGCAGG + Intronic
1128087112 15:64894106-64894128 ATGGCTCGGGAGCAGGTGGTCGG - Intronic
1128374443 15:67065470-67065492 CCCTCCCCGGAGCAGGGGGCGGG + Intronic
1128874958 15:71194366-71194388 GCTTCTCAGTAGCAGGTGGCTGG - Intronic
1129253365 15:74320549-74320571 CCTGCTGGGGAGCAGGTGGAAGG + Intronic
1129408543 15:75336246-75336268 CCGTCTCGGGAGCGGGAGAGTGG - Intronic
1129850544 15:78791216-78791238 CCATCTCTTGGGCAGGTGGCTGG - Exonic
1130550935 15:84889467-84889489 CCCTCTCAGGAGGAGGTGGGAGG + Intronic
1131832353 15:96361751-96361773 TCATCCCGGGAGTAGGTGGCTGG + Intergenic
1132250502 15:100332441-100332463 TCCTCTGGGGAGCAGGTGGGGGG - Intronic
1132573767 16:655638-655660 CCGTGTGGGGAGCAGGCGGCGGG - Exonic
1132731795 16:1366498-1366520 CTGTCTCTGTAGCTGGTGGCCGG - Intronic
1137398435 16:48133705-48133727 GCGTCTCAGGAGGATGTGGCAGG + Exonic
1141054828 16:80804730-80804752 CGGCTTCGGGAGCAGCTGGCGGG + Intergenic
1141185179 16:81781874-81781896 CCGTCTCGGGGGCGGGCGGGGGG - Intronic
1141839815 16:86567320-86567342 CCGTCTCGGAAGCAGCATGCAGG + Exonic
1142188179 16:88704679-88704701 CCTTCTTGTGAGCAGGTAGCGGG - Intronic
1142493372 17:292911-292933 CAGACCCGGCAGCAGGTGGCTGG - Intronic
1142713073 17:1733788-1733810 CCATCTCGGGGGTGGGTGGCGGG + Exonic
1142878117 17:2864592-2864614 CGGTGTGGGGAGCAGGAGGCTGG + Intronic
1143778215 17:9213093-9213115 CGGTCAGGGGAGCAGGTGGGAGG + Intronic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147193470 17:38749916-38749938 CAGGCTCCGGAGCAGGTGACCGG - Exonic
1149075902 17:52595999-52596021 CCGTCTTGGGAACAGGTAGGAGG - Intergenic
1151521464 17:74633388-74633410 CTGTCTGGGGAGCAGGGAGCTGG - Intergenic
1151729931 17:75905037-75905059 CTGCCTCGGGCGCAGGTGGAAGG + Exonic
1152037688 17:77883467-77883489 CCGGCTCTGATGCAGGTGGCTGG - Intergenic
1152241938 17:79165474-79165496 CCCTCTGGGGGACAGGTGGCGGG + Intronic
1152509784 17:80778685-80778707 GCTTCTCGGGAGAAGGAGGCAGG + Intronic
1152553419 17:81040974-81040996 CCCTCTAGGGGGCAGGAGGCTGG + Intronic
1152739731 17:82013638-82013660 CCCTCTCGGAAGCCGGGGGCCGG - Intronic
1158649474 18:59273132-59273154 CGGGCTGCGGAGCAGGTGGCCGG + Exonic
1159915231 18:74182507-74182529 ACGGCTCGGAAGCAGGTGCCAGG - Intergenic
1160802578 19:977162-977184 CAGGCTCGTGGGCAGGTGGCTGG - Intergenic
1160858210 19:1226833-1226855 CCGTCTCGGGGCCTGGTGTCTGG + Intronic
1161043276 19:2121375-2121397 CTGTCTCAGGAGCAGGTGTTGGG - Intronic
1161236872 19:3202514-3202536 CCATCTCGGGAGCAGGTGACTGG - Intronic
1166544514 19:43626062-43626084 CCCTCGCGGGTGCGGGTGGCTGG + Intronic
1166568363 19:43778814-43778836 CCCCCTGGGGAGCAGGTGTCTGG + Intronic
1167975989 19:53226264-53226286 CCGTCTCGGGGGGGGGTGGGGGG + Intergenic
1168337123 19:55603014-55603036 CCGTTGTGGGAGCAGGTGGAGGG + Exonic
930099216 2:47590109-47590131 CAGTCTGGGGAGGAGGTGACAGG + Intergenic
943432100 2:187816951-187816973 CAGCCTCGGGTGCAGGTGTCTGG + Intergenic
946173643 2:217909742-217909764 TCAGCTTGGGAGCAGGTGGCAGG + Intronic
946868881 2:224068103-224068125 TCCTGACGGGAGCAGGTGGCTGG + Intergenic
947402465 2:229743190-229743212 CCGTCTGGGAGGGAGGTGGCGGG + Intergenic
948908634 2:240991937-240991959 CCGTCACGGTGGCAGGTGGCTGG + Intronic
1169200473 20:3706770-3706792 CCTTCTCTGGGGCAGGTCGCAGG - Intronic
1169231139 20:3889536-3889558 TCGGCTGGGGAGCAGGCGGCCGG + Exonic
1170226480 20:13996061-13996083 CCGCCTCGGGAGAAGGTGACGGG - Intronic
1172830385 20:37829102-37829124 CCATCTGGGGGGCAGGGGGCAGG + Intronic
1173400664 20:42723333-42723355 CCAGCTCGGAAGCAGCTGGCAGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1176111327 20:63412081-63412103 TTGACTCGGGAGCGGGTGGCGGG + Intronic
1184764328 22:46563789-46563811 CTGGCTTGGGAGCAGGTGGTTGG + Intergenic
954871834 3:53773253-53773275 CCGTCGCGGGAACAGAAGGCTGG + Intronic
955235530 3:57135837-57135859 CCGGCTCTGGAGCAGGTGACGGG - Intronic
955348957 3:58180179-58180201 CTATCACGGGAGCTGGTGGCAGG - Intergenic
963770115 3:149380165-149380187 CCGTCTCGGAGGGAGGTGGGGGG + Intergenic
967432088 3:189397388-189397410 CCTTCTCGGGAGGATGAGGCAGG + Intergenic
984778713 4:183505387-183505409 CGGCCTCGGGAGCCGGTGGCGGG + Intronic
985592084 5:770841-770863 CCGCCCCCAGAGCAGGTGGCTGG + Intergenic
991214762 5:64149235-64149257 CCTTCTCTGGTGGAGGTGGCAGG + Intergenic
994353373 5:98770302-98770324 CCTTCTTGGGAGCGAGTGGCTGG + Intronic
996631908 5:125643031-125643053 CCTGCTCTGGAGGAGGTGGCAGG - Intergenic
997874738 5:137537757-137537779 CCGTCTGGGAGGGAGGTGGCGGG - Intronic
998226749 5:140333020-140333042 CCTTCTCGGTAGCAATTGGCAGG + Exonic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000264553 5:159622003-159622025 CCTTCTCTGGTGGAGGTGGCCGG - Intergenic
1003264361 6:4552486-4552508 GCTTCTTGGGAGTAGGTGGCTGG - Intergenic
1004216885 6:13711612-13711634 CCGCCCCGGAAGCAGGCGGCGGG + Intergenic
1006167662 6:32074638-32074660 CTGTGGCGGGAGCAGGTGTCAGG - Intronic
1006694744 6:35921209-35921231 CCTCCTCGGGAGCAGGTGGTAGG - Exonic
1011503097 6:88012388-88012410 CCCCCTCGGGAGCAGGTGGTAGG + Intergenic
1013221267 6:108080035-108080057 CCTGCTCTGGAGGAGGTGGCAGG + Intronic
1015682006 6:135818646-135818668 CAGTCTTCAGAGCAGGTGGCGGG + Intergenic
1017822634 6:158060343-158060365 GCGCCTGGGGAGCAGGGGGCGGG - Intronic
1018628697 6:165804706-165804728 CCGGCTCGGCTGCAGGTGGGAGG + Intronic
1018893640 6:167999134-167999156 GCGTCTCAGGAGCTGGTGCCCGG + Exonic
1019171735 6:170136725-170136747 CGGTCTGAGGAGCCGGTGGCAGG - Intergenic
1019427288 7:983619-983641 CCGGCGCGGGAGCAGGAGTCTGG + Intronic
1021697925 7:23291890-23291912 CCCTCTCGGGAGGCGGAGGCAGG + Intergenic
1022894814 7:34739791-34739813 CCTGCTCTGGTGCAGGTGGCAGG + Intronic
1029202216 7:98846781-98846803 CCACCTCGGGAGCAGCTGGCAGG + Exonic
1042916171 8:73878337-73878359 GCGTCTCCGGAGAAGGCGGCTGG - Intronic
1049039949 8:140105037-140105059 CAGTCCTGGGGGCAGGTGGCTGG - Intronic
1049693783 8:143973818-143973840 GCGTCTCGGAGGCAGGTCGCCGG - Intronic
1052872849 9:33524448-33524470 GCGTCTCAGGAGCGGGTGGTGGG + Exonic
1057901715 9:98953973-98953995 CACTCTCTGGAGTAGGTGGCAGG + Intronic
1062261723 9:135666247-135666269 CCTTCCCGGGAGCTGGTGGAGGG - Intronic
1062406778 9:136400397-136400419 CCGGATCGTGACCAGGTGGCCGG - Intergenic
1062544038 9:137053835-137053857 ACGTCTGGGGAGCAGCGGGCCGG - Intronic
1062600392 9:137316486-137316508 CGGTCCCGGCAGCAGGTGGCAGG + Intronic
1185892484 X:3833741-3833763 CAGGTTCTGGAGCAGGTGGCGGG - Intronic
1185897592 X:3872160-3872182 CAGGTTCTGGAGCAGGTGGCGGG - Intergenic
1185902711 X:3910592-3910614 CAGGTTCTGGAGCAGGTGGCGGG - Intergenic
1197736022 X:129850808-129850830 CCGTCTGGGAAGGAGGTGGGGGG + Intergenic
1197751179 X:129964666-129964688 CCGTCTCGGGAGGCTGAGGCAGG - Intergenic
1198214912 X:134546544-134546566 CCGGCTCAGGAGCAGGTAGGTGG - Intergenic
1199717042 X:150514398-150514420 CTGCCTCGGGAGCAGGTGTGGGG + Intergenic
1200073359 X:153539593-153539615 CCGTCCCTGCAGCAGATGGCAGG + Intronic