ID: 1083934283

View in Genome Browser
Species Human (GRCh38)
Location 11:65862276-65862298
Sequence CAGGGTGAGCACAGGGATCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083934272_1083934283 17 Left 1083934272 11:65862236-65862258 CCAAGGAGGAGCTGCTGCAGAGG 0: 1
1: 1
2: 7
3: 66
4: 535
Right 1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG 0: 1
1: 0
2: 3
3: 29
4: 371
1083934271_1083934283 28 Left 1083934271 11:65862225-65862247 CCACTTCTTAACCAAGGAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG 0: 1
1: 0
2: 3
3: 29
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083934283 Original CRISPR CAGGGTGAGCACAGGGATCA GGG Exonic
900118322 1:1038038-1038060 AAGAGTGAGCTCAGGAATCACGG - Intronic
900133627 1:1103561-1103583 CAGGGTGCACGCAGGGGTCAGGG + Intronic
900427178 1:2586197-2586219 GAGGGTGAGCGCAGGGGTCGCGG - Intergenic
900718540 1:4160404-4160426 CAGGGCTGGCACAGGGACCATGG + Intergenic
901221021 1:7583848-7583870 TAGGGTGAGGACAGTGATCTGGG - Intronic
901399657 1:9007187-9007209 CTGCGTGAGCACGGGGACCAAGG + Intronic
901464572 1:9413115-9413137 CAGGGTGAGGACAGGGCTGCGGG - Intergenic
901510969 1:9717889-9717911 CAGGTTCAGCCCAGGGATCCGGG + Intronic
901638462 1:10681236-10681258 CAGGGTGAGGATGGGGATGAGGG - Intronic
902452513 1:16506188-16506210 CAGGCAGAGCTCAGGGATCTAGG - Intergenic
902472569 1:16658862-16658884 CAGGCAGAGCTCAGGGATCTAGG - Intergenic
902486236 1:16748581-16748603 CAGGCAGAGCTCAGGGATCTAGG + Intronic
902500227 1:16906099-16906121 CAGGCGGAGCTCAGGGATCTAGG + Intronic
903085150 1:20850185-20850207 AAGGCCGAGAACAGGGATCAAGG + Intronic
903269142 1:22176970-22176992 CAGGGTGAGCCCAGAGGACATGG + Intergenic
903569099 1:24291290-24291312 CAGGGTGTGAGCAGGGAACAGGG - Intergenic
903684368 1:25120146-25120168 GAGGGTGTGCTCAGGGATCCTGG - Intergenic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
903768253 1:25748483-25748505 CAGGGTGAACACAGGACACAGGG - Intronic
903849505 1:26297497-26297519 CAGGGTGAGCACAGGGCCTGTGG + Intronic
903967874 1:27101293-27101315 CGGGGTGAGCACAGGCAGCTGGG + Intronic
903974805 1:27142446-27142468 CAGAGTGAGAACAGAGAACAGGG + Intronic
905016894 1:34783907-34783929 CAGGCCCAGCACAGGGAGCAGGG + Intronic
905033360 1:34902250-34902272 CAGGGACAGCATAGGGTTCAGGG + Intronic
905278864 1:36836247-36836269 CATGGTGGGCACTGGGGTCATGG + Intronic
905348405 1:37327566-37327588 AAGGGTGGGCCCAGGGAACATGG + Intergenic
905770940 1:40637372-40637394 CAGGCTGAGAACAGGGTGCAGGG + Intronic
907304387 1:53505684-53505706 CAGGGTGGGCACAGGGCTTCTGG + Intergenic
907486607 1:54782345-54782367 CAGGGTGTGCCCAGGCTTCAAGG - Exonic
908367922 1:63445643-63445665 CAGGCTGAGTGCAGTGATCATGG + Intronic
910649692 1:89552725-89552747 CCTGGTGAACACAGGGAGCAGGG - Intronic
912762744 1:112383467-112383489 CAAGGTGGGAACAGGGAGCAGGG + Intergenic
912871406 1:113310479-113310501 GAGGGAGAGCACAGGGATTGTGG + Intergenic
912978258 1:114348776-114348798 CAGCCTGAGCACAGGAATCCTGG + Intergenic
913645507 1:120850560-120850582 TAGGTGGAGCTCAGGGATCAAGG - Intergenic
914081221 1:144412977-144412999 TAGGTGGAGCTCAGGGATCAAGG + Intergenic
914176130 1:145281517-145281539 TAGGTGGAGCTCAGGGATCAAGG + Intergenic
914517325 1:148385032-148385054 CAGGTGGAGCTCAGGGATCTAGG - Intergenic
914530856 1:148523002-148523024 TAGGTGGAGCTCAGGGATCAAGG + Intergenic
914748173 1:150514496-150514518 CAGAGTGCGCACAAGGGTCAAGG + Intergenic
915444891 1:155968987-155969009 CAGAGTGAGGACAGGGAGCAAGG + Intronic
915597583 1:156904349-156904371 CAGGGGGAGCAAAGGAAACAGGG + Intronic
916046113 1:161000917-161000939 CAGGGTGTGCCCTGGGATAAGGG + Intronic
916358067 1:163935614-163935636 CAAGATGAGCTCAGGGATCTGGG + Intergenic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
917080496 1:171252539-171252561 GATGGAGAGCACAGGGCTCAGGG - Intronic
917798932 1:178552917-178552939 CAGGGAGAGAACAGGGAGCAAGG + Intergenic
918059958 1:181052507-181052529 CAGGGTAAGGACGGGGATCGTGG + Exonic
919025288 1:192161287-192161309 GAGGGTGAGGACAAGCATCAAGG + Intronic
920319107 1:205104088-205104110 GAGGGTATGGACAGGGATCAGGG - Intronic
921266783 1:213427372-213427394 CAGGGTGTGCATATGGTTCAAGG - Intergenic
921813773 1:219544169-219544191 CTGGGTGAGCACAGGCAGCAGGG + Intergenic
922606857 1:226894917-226894939 CCAGGTGAGCACAGGGAACCAGG - Intronic
922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG + Intergenic
924737211 1:246768990-246769012 CAGGGCCAGCAAAGGCATCACGG - Intergenic
1062992851 10:1836489-1836511 CTGGGTGAGGCCAGGGATCTGGG + Intergenic
1065561491 10:26968414-26968436 CAGGGTGAGCACAGGGGCTGTGG - Intergenic
1065963866 10:30755048-30755070 CAGGAGGAGCACAGGGATGGAGG - Intergenic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1067892776 10:50150696-50150718 CAGGGTGCTCTCAGGGACCACGG - Intergenic
1069749717 10:70737369-70737391 CAAGGTCACCACAGTGATCAAGG - Intronic
1071919100 10:90329360-90329382 CAGGATGAGTTCAGGGATCTGGG - Intergenic
1073260819 10:102188858-102188880 CAGAGTGGGCACCGGGAGCAGGG + Intergenic
1074528189 10:114279061-114279083 CAGGGTGAGCACTGGTGGCAGGG + Intronic
1074757218 10:116632974-116632996 CAGTGTGGGCACAGGGAACGTGG + Intronic
1074876856 10:117620421-117620443 CAGGGAGAGCATAGAGACCAGGG + Intergenic
1075734952 10:124658856-124658878 CAGTGGGGGCACAGGGAGCAGGG - Intronic
1075791715 10:125089427-125089449 CAGGGGGAGCACAGGTGTCTAGG + Intronic
1075940277 10:126385727-126385749 TAGGGTGAGCAAAGGGAGAATGG + Intronic
1076192674 10:128493897-128493919 CAGTGTGAGCACAGGCCTGAAGG + Intergenic
1076221284 10:128734956-128734978 CAGGGTCAGAAGAGGGAGCACGG + Intergenic
1076591771 10:131588466-131588488 CAGAGAGAGCCCAGGGAACAGGG + Intergenic
1076768566 10:132650972-132650994 CAGGGTGAGCACAGGGGGAGTGG + Intronic
1076802081 10:132835497-132835519 CATGGTGAGCACTGGGAAAAGGG + Intronic
1077301278 11:1848320-1848342 CTGGGGGAGCCCAGGGTTCAGGG - Intergenic
1077350717 11:2091966-2091988 CAGGGAGAGGACAGAGATCCCGG - Intergenic
1077478719 11:2803110-2803132 CAGAGTGAGCAAGGGGCTCAGGG + Intronic
1077486185 11:2839333-2839355 CAGGGTGGGGACAGAGGTCATGG - Intronic
1077985913 11:7350905-7350927 GAGAGTGAGCAATGGGATCAGGG - Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078512367 11:11994940-11994962 CAGACTGAGGACAGTGATCATGG - Intronic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1079279372 11:19073656-19073678 CAGGGTGGCGACAGGGACCAGGG + Intergenic
1082007642 11:47428670-47428692 CAGGTTGATGACAGGGATGAAGG - Intergenic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1085768219 11:79302680-79302702 CAAGGTGAACTCAGGGAACAGGG - Intronic
1086677188 11:89622605-89622627 AACGGTGAGCACAGAGATGATGG - Intergenic
1088750353 11:112837442-112837464 CAGGGTAAGGCCAGGGACCAGGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090610642 11:128467552-128467574 GAGGCTGGGCACAGGGATAAGGG - Intronic
1091034107 11:132217840-132217862 GAGGGGGAGCACAGGGCTCAGGG - Intronic
1095833549 12:46613063-46613085 CAGGGTTAGTAGAGGGAACATGG - Intergenic
1095968543 12:47885286-47885308 CAAGGTCAGCACTGGGGTCAGGG - Intronic
1096850246 12:54430881-54430903 CAGGATGAGCTCAGTGATCTAGG + Intergenic
1097961474 12:65535704-65535726 GAAGGTAAGCACAGGGAACACGG + Intergenic
1099389862 12:82066901-82066923 CAGGGTGAGTTCAGGGCTCTAGG + Intergenic
1101580970 12:106040493-106040515 CAGGGTGGGCACCAGGAGCAGGG + Intergenic
1102480764 12:113221659-113221681 GAGGGAGAGGGCAGGGATCAGGG + Intronic
1102786535 12:115609587-115609609 CAGAGTGAGAGCAGGGATCCAGG + Intergenic
1102993339 12:117330397-117330419 CAGTGGGAGCAGAGGGGTCAAGG - Exonic
1104380011 12:128299101-128299123 AAGGTTGAACACAGGGCTCAGGG - Intronic
1108002282 13:45915311-45915333 CAGAGTGGGTACAGGGAGCAGGG - Intergenic
1108683511 13:52799383-52799405 CAAGGTGAGGAAAGGGCTCATGG + Intergenic
1109295356 13:60524226-60524248 CTGGCTGAGCACGGGGCTCATGG + Intronic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1112175430 13:97018771-97018793 CAGGGTGAGCACAGGGCCCAGGG - Intergenic
1117490210 14:56239775-56239797 CAGTGAGAGCACAGAGCTCAGGG + Intronic
1118303402 14:64634766-64634788 CAGGAGGTGCACAGGGAACAGGG + Intergenic
1118819010 14:69333049-69333071 CAAGGTGAGGACAGAGCTCAGGG - Intronic
1118838848 14:69496177-69496199 CAAGGAGAGCACAGGGCTCTGGG - Intronic
1118945236 14:70379455-70379477 CAGTTTGAGCACAGGTATAAAGG - Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1119532623 14:75373667-75373689 CAGGATGAGCATAGGAGTCATGG + Intergenic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1120032311 14:79656142-79656164 TAGTGTGAGCACAGGGCTTAAGG + Intronic
1120263300 14:82216234-82216256 CAGGCTGAGCTCTGGGATCTGGG - Intergenic
1121463983 14:94102441-94102463 GAGGGTGAGCACAGGGCACAGGG - Intronic
1121510545 14:94509844-94509866 AAAGATGATCACAGGGATCAGGG - Intronic
1121690392 14:95874163-95874185 CTGTGTGGCCACAGGGATCATGG + Intergenic
1122027102 14:98886047-98886069 CAGGGTGACCACAGGCTGCAGGG + Intergenic
1122277873 14:100604473-100604495 CAGGAGGAGCAAAGGGCTCACGG + Intergenic
1123931715 15:25175206-25175228 CAAGGGGAGAACAGGGCTCAGGG - Intergenic
1124571189 15:30865686-30865708 CATGGTGAGTACAGAGACCAAGG - Intergenic
1124627092 15:31314419-31314441 CAGGGAGATGACAGGGATGATGG - Intergenic
1124631630 15:31340978-31341000 CAGGATGAACACAGGGCACAGGG - Intronic
1125727277 15:41874515-41874537 CAGAGTGAGCACAAGGCTCCTGG + Intronic
1128103778 15:65028489-65028511 AAGGGTGTGCAAAGGGAACATGG + Intronic
1129727182 15:77907314-77907336 CAGGGTGGCCATGGGGATCAAGG + Intergenic
1131324049 15:91425326-91425348 CAGGGTGAACACAGCAAACATGG - Intergenic
1132299012 15:100765133-100765155 CTGGCTGAGCACAGGGCTCTGGG - Intergenic
1132584943 16:702027-702049 CAGAGTGAGCCTAGGGAGCACGG + Intronic
1132608163 16:802085-802107 CAGGGCGGGCACTGGGATCAGGG - Intergenic
1132752432 16:1464972-1464994 CAGGGCAAGGACAGGGATCTTGG - Intronic
1133848566 16:9480123-9480145 GAGGGTGAGCACTGGGGTGATGG + Intergenic
1134031704 16:10997160-10997182 CAAGATGAGCACAGGAAGCATGG - Intronic
1134233718 16:12449368-12449390 CACGGCAAGGACAGGGATCATGG + Intronic
1134452794 16:14373690-14373712 CAGGCTGGGCTCAGGGTTCACGG - Intergenic
1134608705 16:15590945-15590967 CAGTGTGAGCACATTGCTCAAGG - Intronic
1135967658 16:27049282-27049304 ATGGGTGAGCACAGGGATGTGGG - Intergenic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1136035979 16:27540798-27540820 GAGTGTGTGCACAGGGATTAGGG + Intronic
1137476982 16:48817663-48817685 CTGGGTGAGCACAAGGGTCCAGG - Intergenic
1138132687 16:54494682-54494704 CATGGTGACTACAGGGATCTCGG - Intergenic
1138445126 16:57058750-57058772 CAGGGTGAGTGCAGCGCTCAAGG + Intronic
1138895226 16:61196616-61196638 CATGGTCTGCACAGGGATCTGGG - Intergenic
1139916250 16:70430191-70430213 CAGGGTATGCCCAGGGATCCAGG + Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1142131498 16:88433485-88433507 CGGGGTGAGCCCAGGGGGCACGG + Exonic
1143407893 17:6690240-6690262 CTTGGTGAGCACAGGGATAAGGG - Intronic
1145001779 17:19310343-19310365 CAGGGTGGGCGCAGGGATGCAGG + Intronic
1145386916 17:22420836-22420858 CAGGGTCAGCTCAGGCCTCACGG + Intergenic
1145825447 17:27873765-27873787 GAGGGAGAGCACAGGGAACACGG - Intronic
1146390120 17:32414379-32414401 CAGGGTGGGTACAGGGAGAATGG - Intergenic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1150201606 17:63362726-63362748 CAGAGTGGGCACTGGGAACAGGG + Intronic
1151360108 17:73583714-73583736 CAGGGTGAGCACACGGGTGGTGG + Intronic
1151445184 17:74159112-74159134 CAGGGGGAGCACTGGGGGCAGGG - Intergenic
1152572006 17:81125040-81125062 CAGGGTGAGCAGGGTGAGCAGGG + Intronic
1152573302 17:81129775-81129797 CAGGGTCAGCACAGGGCTCAGGG + Intronic
1152576613 17:81143952-81143974 CAGGGTGAGCACGGTGCCCAGGG + Intronic
1152596509 17:81240231-81240253 CAGAGTCAGCACTGGCATCAAGG - Intronic
1152750656 17:82061016-82061038 CAGGCTGAGCACTGGGCACACGG + Intronic
1152941005 17:83172908-83172930 CTGGGTGAGCACTGGGGTGAGGG + Intergenic
1153838997 18:8989600-8989622 CAGGCTGAGTAGAGGCATCAAGG + Intergenic
1154415680 18:14174141-14174163 CAGGGTCAGGACAGGGGGCAGGG + Intergenic
1154978534 18:21482778-21482800 CAGCGAAAGCACAGGGAGCATGG + Intronic
1155332362 18:24731220-24731242 CAGGTTACGCACAGGAATCAAGG - Intergenic
1156341117 18:36211583-36211605 CAGGATGAGCACAGCATTCAGGG - Intronic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1156461952 18:37326210-37326232 AAGGGAGAGCAGAGGGGTCAGGG + Intronic
1156733357 18:40223149-40223171 CAGGTTTGGCACAGGGAACAGGG - Intergenic
1157247867 18:46070331-46070353 CAGGGTGAAGACAGGGTTCCAGG - Intronic
1157299214 18:46467640-46467662 CAGGCTGGGCACAGCAATCAGGG + Intergenic
1157719942 18:49915976-49915998 GATGGTGAGCACAGGGACCAAGG - Intronic
1158185367 18:54765317-54765339 GAGGGTGAGCACTGGGCTCCAGG - Intronic
1159893909 18:73978855-73978877 CAGGGTGAGCACAGAGAGCTAGG + Intergenic
1160537952 18:79604918-79604940 CAGGGGGACCACAGGCCTCAGGG + Intergenic
1160663866 19:313778-313800 CAGGAGGAGCACAGGGATGGCGG - Intronic
1160807935 19:1000805-1000827 CAGGCTGAGCACGGGGGTCTCGG - Exonic
1160820889 19:1057238-1057260 CAGGGTGGGAACAGGGCTGAGGG + Intronic
1161609264 19:5231841-5231863 CCTGGTGAGCACAGGGTTCTTGG - Intronic
1162042200 19:7977787-7977809 CAGGATGAGCACAAGGCTCCAGG + Intronic
1162141828 19:8589774-8589796 CCGGGTGGGGACAGGGCTCAGGG + Intronic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1163268215 19:16234067-16234089 CAGGATGAGCACAGGCCTCAGGG - Intronic
1163434215 19:17285589-17285611 AGGTGTGAGGACAGGGATCAGGG + Exonic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1165241518 19:34472156-34472178 CAGGGTGAGGACAGGGCACGCGG - Intergenic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166198467 19:41221243-41221265 GAGGGTGAGCTCTGGGGTCAGGG + Exonic
1166230289 19:41422534-41422556 CAGGGAGAGGACAGAGAGCAAGG - Intronic
1166725596 19:45025465-45025487 CAGGGTGAGCACGGAAGTCAAGG - Intronic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167153415 19:47723131-47723153 CAGGGTGGGCAGGGGGATCCAGG - Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168355733 19:55698511-55698533 TAGGGTGAGCACAGGTGGCAGGG - Intronic
1202704961 1_KI270713v1_random:15680-15702 CAGGCAGAGCTCAGGGATCTAGG - Intergenic
925017812 2:544937-544959 GAGGGTGAGAACAGGGGCCAGGG - Intergenic
925693680 2:6551738-6551760 CAAGGTGACCACAGGCATCCTGG - Intergenic
925826808 2:7857490-7857512 CAGGCTGTGCACAGGGGTCCAGG + Intergenic
926148526 2:10411655-10411677 CAGGCTGAGCACTGGGATGCCGG - Intronic
926747013 2:16167095-16167117 CCAGGTTAGCACAGGGATGAGGG + Intergenic
927889852 2:26741503-26741525 GAGTGTGAGCACAGGGCTGATGG + Intergenic
928825520 2:35415971-35415993 CAGGGGGTGCACAGGGAACGAGG - Intergenic
929562085 2:42962283-42962305 GAGGGTGAGCTCTGGGGTCAGGG + Intergenic
931058867 2:58503919-58503941 CAGGGTGAGCAGGGTGAGCAGGG + Intergenic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
933980606 2:87547305-87547327 CAGGGTAAGCATAGGAAGCACGG + Intergenic
936173489 2:110197492-110197514 CAGGGTGAGCAGGGGGCCCACGG + Intronic
936313221 2:111403486-111403508 CAGGGTAAGCATAGGAAGCACGG - Intergenic
937469396 2:122162383-122162405 CAGGGTGAGCCTCGGGATGAAGG + Intergenic
937612209 2:123875759-123875781 TAGAGTGAGCAGAGGGATCTGGG + Intergenic
937905371 2:127050370-127050392 CAGGGGGACCACAGGCATCCTGG - Intronic
938310541 2:130285951-130285973 CAGGGAGAGAATGGGGATCAGGG + Intergenic
938444385 2:131366416-131366438 CAGGGAGAGAATGGGGATCAGGG - Intergenic
938569916 2:132553618-132553640 CTGAGTGAGCACAGAGCTCACGG + Intronic
938932690 2:136100584-136100606 CACGCTGAACACAGGGATGAAGG + Intergenic
939107389 2:137964711-137964733 CAGGCTGGGCACAGGGATAAGGG + Intronic
940180676 2:150929092-150929114 CAGTGAGAGGACAGGGATCCTGG - Intergenic
940183224 2:150956991-150957013 CAGGGTGAGAACAGGAAAGAAGG - Intergenic
943927424 2:193803071-193803093 CAGGGTGAGCGCAGGCAAGATGG + Intergenic
946626999 2:221623704-221623726 CAGGGAGAGAAAAGGAATCATGG - Intergenic
947301005 2:228688754-228688776 CAGGGTAAGCCCAGGGATCGGGG - Intergenic
947374682 2:229483694-229483716 CAGTGTGACCACAGGGTCCAGGG - Intronic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947836610 2:233180434-233180456 CAGGCTGAGCACAGGGGTACAGG - Intronic
948716673 2:239869743-239869765 CAGGGTGACCCCAAGCATCACGG - Intergenic
948967585 2:241395534-241395556 CCAGGTGACCACAGGGATCTGGG - Intronic
1168793569 20:596195-596217 AAGGGTGGGCCCAGGGCTCAGGG - Intergenic
1168840343 20:906044-906066 CAGGATGACCCCAGGGATCCTGG + Intronic
1168947794 20:1776332-1776354 CAGAGCTAGCACAGGGACCAAGG - Intergenic
1169422643 20:5472182-5472204 CAGGGTGGGCACAGTGACCAGGG + Intergenic
1169426827 20:5503600-5503622 CAGGGTGGGCACAGTGACCAGGG - Intergenic
1169850063 20:10038502-10038524 CAGGGTGAGCACCAAGGTCAAGG - Exonic
1172689350 20:36779553-36779575 CAGGGTGAGCCCAGTGAGAAGGG + Exonic
1173042172 20:39474906-39474928 CAAGGCAAGCACAGGGAACAGGG - Intergenic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1174078679 20:47956024-47956046 CAGGGAAAGCACAGGGTTCTAGG + Intergenic
1174117402 20:48236392-48236414 CAGGGTGAGCACACCTAACAAGG - Intergenic
1174463547 20:50699787-50699809 CTGGGTGAGCACATGGACCCTGG + Intergenic
1174739354 20:52997233-52997255 CAAGATGAGCACAGGAACCAGGG - Intronic
1175152563 20:56946606-56946628 CAGGGTGAGCACAACGGACACGG + Intergenic
1175193996 20:57229925-57229947 CAGGGTGAGGGCAGGAAGCATGG + Intronic
1175299433 20:57932456-57932478 GTGGGTGAGCAGAGGGGTCAAGG + Intergenic
1175933394 20:62503891-62503913 CAAGGTGGGCACAGGCACCAGGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176366990 21:6039286-6039308 CAGGGTGAGGACAGGGGACCAGG - Intergenic
1177262717 21:18750811-18750833 AAGGGTGAGCACAGCGGTAAGGG - Intergenic
1177591562 21:23176343-23176365 CAGGAAGCTCACAGGGATCAAGG - Intergenic
1179290464 21:40013765-40013787 CAGGGAGAGCACAGGGTTTGAGG + Intronic
1179403848 21:41109270-41109292 AAGGGTGTGCACATGGAACATGG - Intergenic
1179634185 21:42696821-42696843 CCAGCTGAGCACAGGCATCAGGG + Intronic
1179756528 21:43499260-43499282 CAGGGTGAGGACAGGGGACCAGG + Intergenic
1180011435 21:45053995-45054017 CTGGGTGGGAACAGGGGTCAGGG + Intergenic
1180168118 21:46040516-46040538 CAGGCTGGGCGCAGGGACCAGGG + Intergenic
1180972315 22:19822006-19822028 CATGGCCAGCTCAGGGATCAGGG + Intronic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1181416343 22:22762183-22762205 TAGGCTGAGCTCAGGGTTCAGGG - Intronic
1181668738 22:24415777-24415799 GAGGGTGGGCACAGGGGGCATGG - Exonic
1182476554 22:30579704-30579726 CAGCGTGGGCCCAGGGGTCAAGG + Intronic
1183483627 22:38077931-38077953 CTGGGCGGGCACAGGGCTCAGGG - Intergenic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185250630 22:49799850-49799872 CATGGTGAGGACAGGGCTGAGGG - Intronic
1185305901 22:50115947-50115969 CAGGGAGAGCGAAGGGCTCAAGG - Intronic
950614877 3:14150439-14150461 GAGGGTGCGCCCAGAGATCATGG - Intronic
950686211 3:14620318-14620340 GAGGGAGAGCACAGGAGTCAAGG + Intergenic
950707640 3:14792890-14792912 CAGGGAGAGCACAGGCATCCAGG - Intergenic
951624529 3:24645147-24645169 CAGCCTGGGCACAGGGCTCAGGG + Intergenic
953262755 3:41356143-41356165 CAGGGAGAACACAGGGGACAGGG - Intronic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
954578969 3:51692800-51692822 AAGGGAGAGCAATGGGATCAGGG + Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
957891480 3:86364493-86364515 CAGGAAGAGCAGAGGGGTCAAGG + Intergenic
960702328 3:120450878-120450900 CACGGTGAGCGCAGGGCGCACGG - Exonic
961664255 3:128486392-128486414 CAGGGTGGGCAGAAAGATCAGGG + Intronic
963306516 3:143659664-143659686 CAGGGTGATGACAGGGATAGGGG - Intronic
966861487 3:184233319-184233341 CGGGGTGAGCACAGTGGGCAGGG - Exonic
966942637 3:184756608-184756630 CAGGGGCAGCACAGGGAGAACGG - Intergenic
968601050 4:1509483-1509505 CAGGCAGGGCACAGGCATCAGGG + Intergenic
968801078 4:2743606-2743628 CAGGGTGTGAACAGGGACCCTGG - Intronic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
970733835 4:19142092-19142114 CAAGGTCAGCTCAGGGACCAAGG - Intergenic
971185240 4:24369154-24369176 CAGGGTGAGAACATGGATAACGG + Intergenic
971834703 4:31748282-31748304 CAGAGTGAGCTAAGGCATCAGGG + Intergenic
975299635 4:72774872-72774894 CAGAGTGGGCACTGGGAGCAGGG - Intergenic
976721950 4:88177768-88177790 GAGGGAGAGCACAGCGATTATGG + Intronic
976828320 4:89284654-89284676 CAGGGTGAGAAAAGGGAGCTAGG - Intronic
978733685 4:112061325-112061347 GAGGGACAGCACAGTGATCATGG + Intergenic
979337202 4:119476800-119476822 CAGGCTGAGTGCAGTGATCATGG + Intergenic
979596795 4:122543223-122543245 CAGGGTGTGGATAGGGATCGTGG + Intergenic
980395680 4:132212109-132212131 CGAGGTGACCACAGAGATCAAGG - Intergenic
985662670 5:1165103-1165125 CAGGGAGGGCACAGGGCTCTCGG + Intergenic
986155913 5:5175814-5175836 GAGGGAGAGAACAGCGATCATGG - Intronic
986368663 5:7059703-7059725 CAGGGTGAGGACAGGAAAAAAGG + Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG + Exonic
987117409 5:14736690-14736712 AAGGGGGAGAACAAGGATCAGGG - Intronic
987125916 5:14812578-14812600 CAGGCTGAAGACAGGGCTCAAGG - Intronic
988737587 5:34038267-34038289 TAAGGTGAGCACAGGGAGGATGG + Intronic
990924028 5:60998652-60998674 CAGGATGATCACAGAGATTAGGG - Intronic
991400351 5:66245217-66245239 CAGGGTCTGCACAGGGGACAAGG + Intergenic
992048844 5:72925549-72925571 CTGGGTGGGCACAGGGTCCACGG + Intergenic
993074128 5:83205806-83205828 CAGGGTGAGAATAAGGATGAGGG + Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993975656 5:94476475-94476497 CATGGTGGGAACAGGGCTCAGGG + Intronic
994748885 5:103713651-103713673 CAGGCTGACCTCAGAGATCATGG - Intergenic
997203907 5:132030271-132030293 CCGGGTGAACCCAGGGTTCAGGG + Intergenic
997392877 5:133531339-133531361 CAAGGTGACCACAGAGATTAGGG - Intronic
998881738 5:146652261-146652283 TAGTGAGAGCACAGGGAGCATGG - Intronic
999237735 5:150109115-150109137 CAGGCTGAGCCCTGGGGTCAGGG - Intronic
999684426 5:154089484-154089506 CAGGGCTAGCAGAGGGATCCAGG - Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001855982 5:175011270-175011292 CAGAGTGTGCACAGGGATGTTGG + Intergenic
1003542608 6:7031768-7031790 TAGGGTGAGCACTGGGCTGATGG - Intergenic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1006042649 6:31268986-31269008 CAGTGTGGGGACAGGGGTCACGG + Exonic
1006679690 6:35788061-35788083 CAGGGTGAACACAGAGCTCTGGG - Exonic
1006900003 6:37493854-37493876 CAGGCTGTGCACAGGGCTCAGGG - Intronic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007742530 6:44021645-44021667 GAGGGTGTGCAGAGGGATTAGGG + Intergenic
1012180264 6:96144017-96144039 GAGGAAGAGCACAGGGATTAAGG - Intronic
1012231222 6:96762809-96762831 CAGAGTGGGCACCGGGAGCAGGG + Intergenic
1013796606 6:113895860-113895882 CAGGATGAGCTCTGTGATCATGG - Intergenic
1014014866 6:116518480-116518502 CAGGGACAGAACAGGGATTAGGG + Exonic
1014384639 6:120785801-120785823 CAGAGTGGGCACCGGGAGCAGGG - Intergenic
1015588382 6:134799499-134799521 AAGGGTGAACACAGGGTCCAGGG + Intergenic
1016313330 6:142758372-142758394 CAGGCTGAGCTCAGGATTCAGGG + Intronic
1017614477 6:156229919-156229941 CAGGCTCAGCTCAGGAATCAGGG + Intergenic
1018855806 6:167674052-167674074 CAGAATGAGGACAGGGACCATGG - Intergenic
1020105062 7:5418978-5419000 CCGGGTGAGCACGGGGTTCAAGG + Intronic
1021081171 7:16367216-16367238 CACAGTGGGCACAGGGAGCAAGG - Intronic
1021214741 7:17901610-17901632 GAGGGAGAGCACAGTGATTATGG - Intronic
1021495885 7:21274263-21274285 CTTTGTGAGCACAGGGACCACGG - Intergenic
1021767928 7:23968120-23968142 CGGGGTGAGTAAAGGGCTCAGGG - Intergenic
1022794309 7:33719757-33719779 CAGGGTGTGCACTGGGACCTTGG - Intergenic
1023627279 7:42128808-42128830 CAGGGTGATAACAGGAATTAAGG - Intronic
1023686757 7:42743823-42743845 CAGGCTCAGCACAGGCATCAGGG - Intergenic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1029431423 7:100533446-100533468 CAGGGGGAGCACAGCCAGCATGG - Intergenic
1029804967 7:102986459-102986481 CAGCTTGGGCACAGGGACCATGG - Intronic
1031215327 7:118883094-118883116 GAGGGAGAGCACAGTGATCGGGG + Intergenic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1031500279 7:122506081-122506103 AAGTGGGAGCACAGGGAGCAGGG - Intronic
1032658400 7:133955876-133955898 CAGAGTGGGCACTGGGAGCAGGG + Intronic
1033460747 7:141545481-141545503 CAGGGTGAGTACTTTGATCATGG - Intergenic
1034214522 7:149394895-149394917 GAGGATGAGGACAGGGAGCAAGG - Intergenic
1036486319 8:9182654-9182676 CAGGGAGAGCAGAGGTGTCAGGG - Intergenic
1037743496 8:21625653-21625675 GAGGGGGAGGACGGGGATCAAGG + Intergenic
1037920187 8:22800548-22800570 CAGGGTGGGCACAGCAATGAGGG - Intronic
1038241963 8:25818266-25818288 CAGGGTGGGCTCAGGTATCCTGG + Intergenic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1047719716 8:127628386-127628408 CACGGTGAGCAGAAGGATCTAGG - Intergenic
1049069792 8:140347488-140347510 CAGGCTGAGGACAGGGCTGAAGG - Intronic
1049281670 8:141752721-141752743 CAGGGTCAGCACCGGTGTCAGGG + Intergenic
1049471253 8:142775937-142775959 CAGGGTGAGCAGGGGCGTCATGG + Exonic
1050632931 9:7579795-7579817 CACATTGAGCACAGGGATCTTGG + Intergenic
1053201049 9:36151760-36151782 CAGGGGGAGCCCAGGGCACAGGG - Intronic
1053416317 9:37949016-37949038 CAGTGTGAGGACAGGCATCATGG + Intronic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1056658665 9:88529062-88529084 CAGGCTGAGCACGGGGTCCAAGG + Intergenic
1056959671 9:91112104-91112126 CTGGCAGAGCACAGGGACCAGGG + Intergenic
1057044005 9:91870363-91870385 CAGGGTACACACCGGGATCAGGG + Intronic
1058551978 9:106124484-106124506 CAGGCTGAGCTCAGGATTCAAGG + Intergenic
1060092998 9:120761255-120761277 CATGGTGTGGACAGGGATCCAGG - Exonic
1060595338 9:124844427-124844449 AAGGGTGAGCCCAGGAGTCATGG + Intergenic
1060970344 9:127734261-127734283 CATGGTGAGAACAGTGGTCAAGG + Intronic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1061884897 9:133586477-133586499 CAGAAAGAGCACAGGGACCATGG + Intergenic
1062029485 9:134355816-134355838 CAGGGTGAGCCCAGGGCCCTGGG - Intronic
1062053598 9:134459422-134459444 CAGGGTGAGGTCAGGGAGAATGG + Intergenic
1062378543 9:136275873-136275895 CATGGAGAGCCCAGGGCTCAGGG + Intergenic
1062427488 9:136512621-136512643 CAGGGTGGGCGCCGGGAGCACGG + Intronic
1062490432 9:136802783-136802805 CAAGGTGAGCTCAGGGCCCAGGG + Exonic
1062490458 9:136802851-136802873 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490484 9:136802919-136802941 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490511 9:136802987-136803009 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490537 9:136803055-136803077 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490564 9:136803123-136803145 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490589 9:136803190-136803212 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490615 9:136803258-136803280 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062504335 9:136865694-136865716 CAGGGTGGGCACTGGGAACGGGG - Intronic
1062722346 9:138050971-138050993 CAGGAAGAGCACAGGGGGCAGGG + Intronic
1185470441 X:378536-378558 CAGGGTGAGGACAGGATTCTGGG - Intronic
1185750587 X:2607770-2607792 CACGTTGAGCAAAGGTATCAGGG - Intergenic
1187167180 X:16814982-16815004 CAGGGTTAGGACAGGCCTCAGGG + Intronic
1188972405 X:36633563-36633585 GAGGGAGAGCACAGTGATTATGG - Intergenic
1189172378 X:38922221-38922243 GAGGGTGATCCCAGGGAGCAGGG + Intergenic
1189628050 X:42920736-42920758 GAGGGAGAGCACAGTGATCGTGG + Intergenic
1190931950 X:54956282-54956304 CAGGGAGAACAGAGGTATCAAGG + Intronic
1192597914 X:72431065-72431087 CAGGGAGAAGGCAGGGATCAGGG - Intronic
1193881531 X:86928508-86928530 AAGGGAGAGCACAGCTATCAGGG - Intergenic
1194535622 X:95103204-95103226 CAGGGTGAGCAATGGGGGCATGG + Intergenic
1197512688 X:127390253-127390275 CAGGGTGACCACAGAGGTCCTGG + Intergenic
1200979607 Y:9250343-9250365 CAGGTTGCCAACAGGGATCAGGG - Intergenic
1202233049 Y:22675725-22675747 CAGGCTGCCAACAGGGATCAAGG - Intergenic
1202310107 Y:23520433-23520455 CAGGCTGCCAACAGGGATCAAGG + Intergenic
1202560694 Y:26150160-26150182 CAGGCTGCCAACAGGGATCAAGG - Intergenic