ID: 1083934708

View in Genome Browser
Species Human (GRCh38)
Location 11:65864202-65864224
Sequence TGTACCTTGGTACTTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083934704_1083934708 2 Left 1083934704 11:65864177-65864199 CCTCCAGGAGTGGAAATACAGAG 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1083934708 11:65864202-65864224 TGTACCTTGGTACTTGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 88
1083934706_1083934708 -1 Left 1083934706 11:65864180-65864202 CCAGGAGTGGAAATACAGAGGCT 0: 1
1: 0
2: 0
3: 14
4: 185
Right 1083934708 11:65864202-65864224 TGTACCTTGGTACTTGCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083934708 Original CRISPR TGTACCTTGGTACTTGCTGC TGG Intronic
905938399 1:41843004-41843026 TGTACCCTGGAAATTGTTGCTGG + Intronic
907296999 1:53461617-53461639 TCCGCCTTGGTACTGGCTGCGGG - Exonic
907360135 1:53907511-53907533 TGTACCTTGGGACATGGTTCAGG + Intronic
914707396 1:150181631-150181653 TGGGCCTTGGTGCTTCCTGCAGG + Intergenic
917283943 1:173405152-173405174 TTTACCTTGGGACTTGCCGTTGG - Intergenic
917839016 1:178962566-178962588 AGTAACTTGGTACTTCCAGCAGG - Intergenic
922230834 1:223684202-223684224 TGGTCCTTGTTACCTGCTGCTGG - Intergenic
923082825 1:230675520-230675542 AATTCCTTTGTACTTGCTGCTGG - Intronic
924722708 1:246638199-246638221 TGTACCATGGTCCTTGCTTTTGG + Intronic
1064170228 10:13025186-13025208 TGTAAATTGGTACTGGATGCTGG + Intronic
1065375779 10:25039975-25039997 TGGGCCTTGGTGCTGGCTGCTGG + Intronic
1069293687 10:66815830-66815852 TGCCCCTTGGTATTTGCTGTAGG - Intronic
1071504732 10:86225789-86225811 TGTACTTTAGTACCTGCTGCTGG + Intronic
1071764825 10:88651790-88651812 TGTCCCTTGCTACTTTATGCTGG + Intergenic
1075184510 10:120243642-120243664 TGGAACCTGGTACTTGCTACTGG - Intergenic
1079309627 11:19353329-19353351 TGTAGCTTGGTGATTGCTGGGGG + Intronic
1083934708 11:65864202-65864224 TGTACCTTGGTACTTGCTGCTGG + Intronic
1086448063 11:86888898-86888920 TGCCCCTGGGAACTTGCTGCCGG + Intronic
1088066210 11:105723052-105723074 TGGACCTTGGGACTTGCCGATGG + Intronic
1090830996 11:130420795-130420817 TGAAACTTGGCACTTGCTCCTGG + Intronic
1091029673 11:132174439-132174461 TGTACCTTGCTACATGCCCCAGG + Intronic
1096315268 12:50559093-50559115 TCCACCTTGGTACATGCTACTGG - Intronic
1099775798 12:87127636-87127658 TGTACCTGGAAACTTGATGCTGG - Intergenic
1101391271 12:104302804-104302826 TATACTTTGCTATTTGCTGCTGG + Intronic
1102510010 12:113408885-113408907 TGTGGTTTGGTACTTGCTGAGGG - Intronic
1106182069 13:27378197-27378219 TGTACCTTGGGCCTTGATGCTGG + Intergenic
1112866995 13:103915803-103915825 TGTACCTTGCTACCTCCTGTTGG - Intergenic
1115747399 14:36451585-36451607 TGGACCTTGGGACCTGCTGCAGG - Intergenic
1116327755 14:43553640-43553662 TGTTCCTTGACACTTGCTTCTGG + Intergenic
1119666950 14:76491631-76491653 TGTACCTGCGTACCAGCTGCAGG - Exonic
1119742762 14:77025461-77025483 TGTACCTTGGGCCTTCATGCAGG - Exonic
1119855720 14:77899046-77899068 TGTCCCTTGGTATATGCTGTGGG + Intronic
1202937113 14_KI270725v1_random:99893-99915 TGTGCCTTGTTTCTTGCTTCTGG + Intergenic
1124053670 15:26222324-26222346 TGGACCTTGGCAGTGGCTGCTGG + Intergenic
1128826591 15:70723549-70723571 TGTACCTTGGTACTCTGTGAGGG - Intronic
1140023350 16:71260755-71260777 TGGACCCTGGTACTTACTACAGG + Intergenic
1143329952 17:6126517-6126539 TGTACCATGGCACTTGCCGAAGG + Intergenic
1145964205 17:28905323-28905345 TGTACATTGGTACTGGTTGTGGG + Exonic
1146730610 17:35190914-35190936 TGTTCCTTGGCAATTGTTGCAGG - Intergenic
1147629918 17:41923515-41923537 TGTACCCTGCAACCTGCTGCAGG + Intronic
1147658119 17:42102398-42102420 TGGACCTTGGGCCTTCCTGCTGG + Intronic
1153170477 18:2310817-2310839 TGTACCCTGGTACTTAATACAGG + Intergenic
1158621386 18:59035587-59035609 TGTGCTTTGGTTCTTGTTGCGGG + Intergenic
1159965059 18:74587261-74587283 TGTTCCTTTGCACTTGCTGCTGG + Intergenic
1164098827 19:22036160-22036182 ATTACCTGGGTACTTGCTCCAGG + Intergenic
1164118708 19:22246384-22246406 ATTACCTGGGTACTTGCTCCAGG + Intergenic
932972946 2:76567830-76567852 TTTACCTTGGGACTTCCTGTGGG + Intergenic
933505276 2:83169553-83169575 TGTAACTTGGGCCTTGCAGCAGG - Intergenic
933988155 2:87611120-87611142 TGTGTCATTGTACTTGCTGCGGG + Intergenic
936305685 2:111339688-111339710 TGTGTCATTGTACTTGCTGCGGG - Intergenic
938339564 2:130526616-130526638 TGTAGAGTGGTTCTTGCTGCAGG + Intronic
938350272 2:130594134-130594156 TGTAGAGTGGTTCTTGCTGCAGG - Intronic
939525682 2:143290868-143290890 TCTACCTCGTTACCTGCTGCCGG - Intronic
943820638 2:192315630-192315652 TGTACATTGGAACTGGCAGCCGG + Intergenic
948023665 2:234758310-234758332 AGTACCTTTGCACTGGCTGCTGG + Intergenic
948444551 2:238022057-238022079 TCTACCTTGGTAATTGCTTAGGG - Intronic
1171404390 20:24900149-24900171 TGGAGCTTGTTACCTGCTGCGGG + Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1174561984 20:51437785-51437807 TGTCCCTTGGTCCCTGCTGAAGG + Intronic
1176360077 21:5987909-5987931 GGCTCCTTGGTACTTGCTGGTGG - Intergenic
1176586208 21:8589214-8589236 TGTGCCTTGTTTCTTGCTTCTGG - Intergenic
1178771107 21:35505047-35505069 TATACTTTGATACTTGCTCCTGG - Intronic
1179763441 21:43550641-43550663 GGCTCCTTGGTACTTGCTGGTGG + Intronic
1180269014 22:10566118-10566140 TGTGCCTTGTTTCTTGCTTCTGG - Intergenic
953632306 3:44629371-44629393 TGTGCCTTGGTGCGTGCTTCTGG - Exonic
955203150 3:56870061-56870083 TGTACCTTACTACTTGCTCTGGG + Intronic
956641998 3:71424193-71424215 TGTCCCTTCCTTCTTGCTGCTGG - Intronic
958801719 3:98763836-98763858 TGGACCTGGGTTCCTGCTGCTGG - Intronic
967259795 3:187630768-187630790 TGTACCATGGTGGATGCTGCCGG - Intergenic
976554409 4:86433353-86433375 TGTATTTTGGTATTAGCTGCAGG - Intronic
980153395 4:129076561-129076583 GGTCTCTTGGTACTTGCTGAAGG - Intronic
981799855 4:148642861-148642883 TGTACCTTGGTCCTATTTGCAGG - Intergenic
989565035 5:42893741-42893763 TTTACCTTGCTAATTGCTTCAGG - Intergenic
994059327 5:95456508-95456530 TGTTCCTTGGGAGTTCCTGCTGG + Intergenic
994964704 5:106653839-106653861 TCCCCCTTGGTGCTTGCTGCTGG - Intergenic
1010192824 6:73210903-73210925 AGTACCTAGGAACTTGCAGCTGG - Intronic
1011730731 6:90260718-90260740 TCTATCTTGGTACTTGCTTCTGG - Intronic
1013396715 6:109748145-109748167 TGGCTCTTGGTACTTCCTGCAGG - Intronic
1015446436 6:133311215-133311237 TGGACCATGGTAGTTGCTTCTGG + Intronic
1021551176 7:21872563-21872585 TATAGCTTGGTAGTTGGTGCTGG - Intronic
1021826074 7:24552716-24552738 TGTACCTTGCTACTTGCTCAAGG + Intergenic
1023641599 7:42264366-42264388 TGTTCTTTGTTTCTTGCTGCAGG + Intergenic
1024490559 7:49977485-49977507 TGTACATTTGTACTTTATGCAGG - Intronic
1025224112 7:57141877-57141899 AGTACCTTGGTACTTGGCCCAGG + Intergenic
1035570067 8:666897-666919 TGCACCTTGGTCCACGCTGCAGG + Intronic
1036758459 8:11488787-11488809 TTTTCCTTAGTAGTTGCTGCAGG + Intergenic
1039740834 8:40381100-40381122 GGTAGCTTGGTATTTGATGCTGG - Intergenic
1041684150 8:60627148-60627170 TGTTCCTTGGTATGTGCTGGAGG - Intergenic
1057102797 9:92378973-92378995 TGGACCTTGATACTTGCAGCTGG - Intronic
1057468049 9:95333827-95333849 TGTAACTTATTACTTTCTGCAGG - Intergenic
1061488321 9:130931580-130931602 TGTTCCTTGGTCCTGGCTTCTGG - Intronic
1203616117 Un_KI270749v1:66729-66751 TGTGCCTTGTTTCTTGCTTCTGG - Intergenic
1186328964 X:8511917-8511939 TGCACCTTGGTCTTTGCTACAGG + Intergenic
1186479842 X:9888209-9888231 TGGGCCTTGGTTCTGGCTGCTGG + Intronic
1195242662 X:102968282-102968304 TATGCCTTGGTACTGCCTGCAGG + Intergenic
1197980646 X:132215763-132215785 AGTACTTTGGTACTTTCTGGGGG + Intronic