ID: 1083935948

View in Genome Browser
Species Human (GRCh38)
Location 11:65870232-65870254
Sequence CTATGTCTAGGGATAGAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083935941_1083935948 26 Left 1083935941 11:65870183-65870205 CCAGGCAGGTTCACGCAGCGGTG 0: 1
1: 0
2: 0
3: 13
4: 321
Right 1083935948 11:65870232-65870254 CTATGTCTAGGGATAGAGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083935948 Original CRISPR CTATGTCTAGGGATAGAGGC AGG Exonic
903325317 1:22565757-22565779 CAAGGTCTAGAGAGAGAGGCAGG + Intronic
906009343 1:42509193-42509215 CTATGTCTAGGGATGGGGAAGGG - Intronic
907641501 1:56195207-56195229 CTATTTCTAAGGAAAGAGTCTGG - Intergenic
909836506 1:80261236-80261258 ATATGCCTAGGCATAGAGGTGGG - Intergenic
910474172 1:87589187-87589209 TTAAGTCTTGGGATAAAGGCTGG + Intergenic
911102951 1:94108275-94108297 CTAGGTCAAGGGCTAGAAGCAGG - Intronic
911200735 1:95040968-95040990 TTAGGTCTAGAGATAGAGGAAGG + Intronic
912450405 1:109764604-109764626 TTATGACTAGAGATAGATGCAGG - Intronic
916523867 1:165590991-165591013 CTATGTATTGTGATAGAGGGAGG - Intergenic
917511272 1:175671122-175671144 CTAAGTCTAGGAAGAGAGACTGG + Intronic
919772158 1:201169132-201169154 CTGTGTGTAGGTATAGAGGTGGG + Intronic
921699990 1:218258329-218258351 CTATGTGTAGGGATTGTGTCAGG - Intergenic
922587925 1:226749855-226749877 CTGTCTCTAAGGATAGAGACTGG + Intergenic
1063794592 10:9498448-9498470 GAATGTGTAAGGATAGAGGCTGG - Intergenic
1066981331 10:42419030-42419052 CACTGTCTAGGGTTGGAGGCGGG + Intergenic
1074773627 10:116749865-116749887 CTATGTCTAGCGAAGGATGCAGG + Intergenic
1081573981 11:44308371-44308393 CTAGGCCTGGGGACAGAGGCTGG - Intronic
1083580672 11:63823125-63823147 CTGTGTCCAGGTATATAGGCTGG + Intronic
1083935948 11:65870232-65870254 CTATGTCTAGGGATAGAGGCAGG + Exonic
1085406034 11:76262795-76262817 CTATGTATACGGAGAGATGCAGG - Intergenic
1090940023 11:131379253-131379275 CTATCACTGGAGATAGAGGCTGG - Intronic
1094445582 12:30526251-30526273 CTATATCTAATGATATAGGCAGG + Intergenic
1094765800 12:33593328-33593350 CTATGTGGAGGGATTGAGTCAGG + Intergenic
1096909930 12:54973234-54973256 CGAGGTCTAGGAATAGAGGTTGG - Intronic
1101463518 12:104923064-104923086 CTATGTCAAAAAATAGAGGCCGG + Intronic
1105415404 13:20207572-20207594 CAATGCCTAGAGATGGAGGCTGG + Intergenic
1106084389 13:26527263-26527285 GGATGGCTGGGGATAGAGGCAGG - Intergenic
1112062606 13:95755998-95756020 CTAAATCTCGGGACAGAGGCTGG - Intronic
1114190841 14:20438370-20438392 CTAAGTCTGGGGATCTAGGCAGG + Intergenic
1115216762 14:31021149-31021171 TTTTGTCAAGGGAAAGAGGCAGG + Intronic
1116552720 14:46262850-46262872 CTATGTGAAGGGATAGTAGCAGG + Intergenic
1117351100 14:54882966-54882988 CTATGTGTAGGGATGGACCCAGG + Intronic
1117714453 14:58566458-58566480 CTATGTCCTGAGATAGAAGCTGG - Intergenic
1119799971 14:77435265-77435287 CTCTGTGTAGTGATAGAAGCAGG + Exonic
1121509776 14:94503758-94503780 CTCTCTCTGAGGATAGAGGCTGG - Intronic
1123215365 14:106804413-106804435 CTATGTCTTGTGAGTGAGGCTGG + Intergenic
1126484406 15:49164077-49164099 CTATTTATAGAGATGGAGGCAGG + Intronic
1127286960 15:57540976-57540998 CTCTGCCTAAGGATGGAGGCAGG + Intronic
1127305309 15:57700077-57700099 CCAAGTCTAGGCATAGAGGCTGG + Intronic
1132514405 16:359552-359574 CTTTGCCTAGGGCTACAGGCTGG - Intergenic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1134892666 16:17854735-17854757 CTAGGTCAAGGGATTGAGACCGG - Intergenic
1140629577 16:76835053-76835075 CTTTCTCTGGGGATAAAGGCTGG - Intergenic
1144348353 17:14369907-14369929 CTGAGGCTAGGGATAGAGGGAGG + Intergenic
1155192809 18:23446270-23446292 CTAAGACTAGGCATAGGGGCAGG - Intergenic
1157017022 18:43727510-43727532 CTATGTGTAGGAATATAGGTTGG + Intergenic
1159116255 18:64116024-64116046 CTAAGACTAGGGATGGAGGAGGG - Intergenic
1162329986 19:10021861-10021883 CCATGTCTAGGCACAGAGGAGGG - Exonic
1165712389 19:38021292-38021314 CAATGTCTGGAGAGAGAGGCTGG + Intronic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
925210256 2:2039252-2039274 CTATGTCTAGGCATGGTGACTGG + Intronic
926473404 2:13290652-13290674 CTCAGTCTAGTGAAAGAGGCAGG - Intergenic
927324393 2:21786828-21786850 TTATCTCTAGGGAGAGAGGAAGG + Intergenic
927707368 2:25304777-25304799 CTATGCCTAGGGGCTGAGGCCGG - Intronic
928553311 2:32396338-32396360 ATATGGCTAGTGATAGAGCCAGG + Intronic
931102892 2:59022142-59022164 CTCTGTCTGAGGATAGGGGCAGG + Intergenic
931804901 2:65794738-65794760 CTCTGTCCAGGAATAGAAGCAGG - Intergenic
935798474 2:106668731-106668753 CTATCTCCAGGGCTAGAGGTGGG + Intergenic
936411702 2:112264352-112264374 CTATGTCTGGGCTTAGTGGCAGG - Intergenic
940349882 2:152671553-152671575 CTATCTCTAAGGAGAGAGGGAGG - Intronic
940981354 2:160007340-160007362 CTAGGTCTGGGGGCAGAGGCTGG - Intronic
942757508 2:179359438-179359460 CAATGTCCAGGGAGAGAGCCTGG + Intergenic
944312358 2:198247906-198247928 CTTTGACTAGGCATAGAAGCAGG + Intronic
945765901 2:213977407-213977429 CTCTATCTAGAGATAGAGGCAGG + Intronic
946265574 2:218538524-218538546 GAATGTCTAAGGACAGAGGCTGG - Intronic
946280423 2:218662180-218662202 GAATGCCTAGGGATAGAGCCAGG - Exonic
1174665844 20:52256983-52257005 CTGTGTCTGTGGGTAGAGGCCGG + Intergenic
1177895353 21:26851048-26851070 CAATGTCTAAGCATAGAGGCTGG + Intergenic
1185119185 22:48955701-48955723 CGATGTCTCGGGCTGGAGGCTGG + Intergenic
949371037 3:3335048-3335070 GTCTGTCTAGGGATAAAGGAAGG + Intergenic
949914890 3:8952463-8952485 CTATGACTGGGGATACAGCCTGG - Intronic
950888238 3:16379393-16379415 CTATGTCTAGGCATTGAGCTAGG + Intronic
951326714 3:21311738-21311760 GTTTGTCTAGGGATGGAGGTGGG - Intergenic
952971779 3:38655693-38655715 CATTGTCTAGGTATAAAGGCAGG - Intergenic
955069197 3:55558131-55558153 CTGTGACTAGGCAGAGAGGCAGG - Intronic
955822482 3:62910602-62910624 AGATGTCAAGGCATAGAGGCTGG + Intergenic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
958819752 3:98959600-98959622 TTATCTCTAGTGATAGAGGTTGG - Intergenic
959515233 3:107258616-107258638 TTAAGTCTAGTGGTAGAGGCAGG - Intergenic
962125882 3:132617258-132617280 GAATCTCTAGGGATGGAGGCTGG + Intronic
963363579 3:144306281-144306303 CTGTGTCTAGTGGCAGAGGCAGG - Intergenic
972871532 4:43305926-43305948 AAATCTCTAGGGATAGAGTCCGG - Intergenic
975848847 4:78551633-78551655 CTGTGTACAGGGATAGAGCCCGG + Exonic
979644660 4:123053872-123053894 ATATGTTGTGGGATAGAGGCTGG + Intronic
980989389 4:139725980-139726002 CAAAGTCTAAGGATAGAGTCAGG + Intronic
981104624 4:140866426-140866448 CTATGTGTGGGAAAAGAGGCAGG - Exonic
981532891 4:145769647-145769669 CTATGTCTGTGGAAAGAGCCAGG + Intronic
983865138 4:172757569-172757591 CTTTGTATAGGAATAGAGACTGG - Intronic
984716213 4:182927860-182927882 CTATGTCTAGAAATGGAGGATGG - Intergenic
986677377 5:10198051-10198073 ATAGCTCTAGGGAAAGAGGCAGG - Intergenic
989280791 5:39640780-39640802 TTGTGACTGGGGATAGAGGCAGG + Intergenic
990579633 5:57155770-57155792 CCATGCCTAGGGAAAGAGGAAGG + Intergenic
990994008 5:61712982-61713004 CAGTGGCTAGGGAGAGAGGCTGG + Intronic
991319266 5:65350942-65350964 CTATGTATAAAGTTAGAGGCCGG - Intronic
992234039 5:74690351-74690373 CTAAGTGTAAAGATAGAGGCTGG + Intronic
994422013 5:99534271-99534293 CTCTGTGTAGGGATAGTGGCTGG - Intergenic
994460829 5:100066313-100066335 CTCCGTGTAGGGATAGTGGCTGG + Intergenic
994484974 5:100379738-100379760 CTCCGTGTAGGGATAGTGGCTGG + Intergenic
994635004 5:102333790-102333812 ATATGTCCAGGGAATGAGGCAGG + Intergenic
994647030 5:102483092-102483114 GAATGGCTAGGGAAAGAGGCTGG + Intronic
996489090 5:124071392-124071414 CTATCTCTAAGGAGAAAGGCAGG - Intergenic
997209415 5:132068693-132068715 CTATGTCTGGAGCTAGAGTCTGG - Intergenic
997267229 5:132501879-132501901 CCAAGGCTAGGAATAGAGGCAGG + Intergenic
998216655 5:140242788-140242810 TTATGTCAAGGTATAGAGGTTGG + Intronic
998473638 5:142402911-142402933 TTATGTGTAGGGAAAGAGGCGGG - Intergenic
998632039 5:143910177-143910199 TTATGGCTAGGCATAGAGGCTGG - Intergenic
1000648518 5:163786344-163786366 CTATGTTTTGGCAAAGAGGCTGG - Intergenic
1001335034 5:170789827-170789849 CTCTGTAAAGGCATAGAGGCAGG - Intronic
1017315647 6:153028198-153028220 CCATTTCTAGGGACAGGGGCAGG + Intronic
1018440243 6:163805905-163805927 AAATGCCTAGGGATAGAGGGAGG + Intergenic
1018868619 6:167764470-167764492 GTATGTCTAGGAATTGGGGCTGG - Intergenic
1021351714 7:19602271-19602293 TTATGTCTAGGCATAGAGCTGGG + Intergenic
1022889371 7:34681156-34681178 CTTGGTCTGGGGATGGAGGCAGG - Intronic
1024434507 7:49334388-49334410 TGATGTGTAGAGATAGAGGCAGG - Intergenic
1030910985 7:115248590-115248612 CTATTCCTAGCGATAGAGGAAGG - Intergenic
1032023184 7:128421448-128421470 CTATGCCTGGGGATGGAGGGAGG - Intergenic
1032122961 7:129169824-129169846 CGATGTCTTGGGTTAGAGGTTGG + Intergenic
1032495130 7:132355707-132355729 CTATGCCTAGGAAGAGAGGGAGG + Intronic
1032508386 7:132452913-132452935 ATATGTGTTGGGGTAGAGGCGGG + Intronic
1032562667 7:132908895-132908917 CTATGTCTAGGGATATGGTTTGG + Intronic
1033245768 7:139715139-139715161 CTAGGTATAGGGATATAGACAGG - Intronic
1038146710 8:24904193-24904215 CCAAGTCTAGGGGTTGAGGCTGG - Intergenic
1038258481 8:25972283-25972305 CCATGACTAGGGATTGAGGGAGG + Intronic
1038353887 8:26808106-26808128 TTATGTCTAGGGATTGAAGGGGG - Intronic
1040504776 8:48037308-48037330 TTCTGACTAGGGATAGAGGTGGG + Intronic
1044840234 8:96331009-96331031 GTAGGTCTAGGGAGAGAGACAGG - Exonic
1048120890 8:131580565-131580587 ATATGTTTTGGGATAAAGGCAGG + Intergenic
1052067033 9:24034660-24034682 CTATGTCCAGGGAGGGAGGAAGG + Intergenic
1055289203 9:74765193-74765215 CTATTTCTAGTGGTAGAGGCAGG + Intronic
1060193440 9:121607674-121607696 CTCTGTCTAAGGACAGGGGCAGG - Intronic
1186024770 X:5297315-5297337 CTATGTCTGCGGATGGATGCTGG - Intergenic
1186066836 X:5775462-5775484 TTCTGTCTAGAGAGAGAGGCAGG + Intergenic
1186901358 X:14060407-14060429 ATACATCTAGGGATAGAGCCAGG + Intergenic
1189825697 X:44914612-44914634 CAAAGTCTAGGGATAGGGTCAGG - Intronic
1191773090 X:64783729-64783751 GAAGGTCTAGAGATAGAGGCAGG + Intergenic
1192040736 X:67618677-67618699 TTCTATCTAGGGATAGAGTCAGG + Intronic
1192466595 X:71361218-71361240 GTTTGTCTAGGGCTAGAGGTGGG - Intergenic
1197248903 X:124194211-124194233 CTTTGTCTAGAGGTAGAGGGAGG + Intronic
1197706818 X:129640092-129640114 GCAGGTGTAGGGATAGAGGCTGG - Intergenic
1199800662 X:151247928-151247950 CTTTGTCTTGGGAGAGAGGTAGG + Intergenic
1201508894 Y:14735854-14735876 CTATGTTTAAGGAAAGAGACTGG + Intronic
1202372330 Y:24207340-24207362 CCATCTGTAGGGCTAGAGGCTGG - Intergenic
1202498455 Y:25462780-25462802 CCATCTGTAGGGCTAGAGGCTGG + Intergenic