ID: 1083936640

View in Genome Browser
Species Human (GRCh38)
Location 11:65872938-65872960
Sequence TGGCGGCGCCGCGGGGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 274}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083936640_1083936652 4 Left 1083936640 11:65872938-65872960 CCCGGTCCCCCGCGGCGCCGCCA 0: 1
1: 0
2: 3
3: 24
4: 274
Right 1083936652 11:65872965-65872987 CCGCCTCCCGGCGCCGGACCAGG 0: 1
1: 0
2: 4
3: 32
4: 246
1083936640_1083936659 26 Left 1083936640 11:65872938-65872960 CCCGGTCCCCCGCGGCGCCGCCA 0: 1
1: 0
2: 3
3: 24
4: 274
Right 1083936659 11:65872987-65873009 GGTCCCCCAGTGCTCGATCCTGG 0: 1
1: 0
2: 0
3: 5
4: 78
1083936640_1083936661 28 Left 1083936640 11:65872938-65872960 CCCGGTCCCCCGCGGCGCCGCCA 0: 1
1: 0
2: 3
3: 24
4: 274
Right 1083936661 11:65872989-65873011 TCCCCCAGTGCTCGATCCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 125
1083936640_1083936650 -2 Left 1083936640 11:65872938-65872960 CCCGGTCCCCCGCGGCGCCGCCA 0: 1
1: 0
2: 3
3: 24
4: 274
Right 1083936650 11:65872959-65872981 CAGGAGCCGCCTCCCGGCGCCGG 0: 1
1: 0
2: 1
3: 19
4: 191
1083936640_1083936653 5 Left 1083936640 11:65872938-65872960 CCCGGTCCCCCGCGGCGCCGCCA 0: 1
1: 0
2: 3
3: 24
4: 274
Right 1083936653 11:65872966-65872988 CGCCTCCCGGCGCCGGACCAGGG 0: 1
1: 0
2: 1
3: 14
4: 92
1083936640_1083936660 27 Left 1083936640 11:65872938-65872960 CCCGGTCCCCCGCGGCGCCGCCA 0: 1
1: 0
2: 3
3: 24
4: 274
Right 1083936660 11:65872988-65873010 GTCCCCCAGTGCTCGATCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 153
1083936640_1083936647 -8 Left 1083936640 11:65872938-65872960 CCCGGTCCCCCGCGGCGCCGCCA 0: 1
1: 0
2: 3
3: 24
4: 274
Right 1083936647 11:65872953-65872975 CGCCGCCAGGAGCCGCCTCCCGG 0: 1
1: 0
2: 2
3: 24
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083936640 Original CRISPR TGGCGGCGCCGCGGGGGACC GGG (reversed) Intronic
900129005 1:1079789-1079811 TGGCTGCGACGGAGGGGACCAGG - Intergenic
900513781 1:3071965-3071987 TGGCGGCTCCGGGGGTGACCCGG + Intronic
900685223 1:3944030-3944052 TGGCGGGGCAGCGGAGGACAAGG - Intergenic
901086327 1:6614180-6614202 GGGCGGCGCTCCGGGCGACCGGG - Intronic
901930796 1:12595403-12595425 GGGCGGGGCCGCGGGGGTCCCGG + Intronic
904171041 1:28592427-28592449 GGGCGGCGCCGGCGGGGCCCCGG + Intronic
904181413 1:28669023-28669045 TCGCGGCGCCGCGGGGGGGTGGG + Intronic
904244987 1:29181494-29181516 TGGCGGCGCCTCGGGGGCGCGGG - Intronic
904772215 1:32886640-32886662 TGGCGGGGGCGCTGGGGACTGGG + Intronic
905124635 1:35708110-35708132 TCGAGGCGCCGCGGGGCTCCGGG + Intergenic
905393983 1:37655687-37655709 TGGCGGGAGCGCGGGGGTCCCGG - Intergenic
906545501 1:46616855-46616877 TGGCGGGGCCGGGGCGGAGCTGG - Intronic
908014226 1:59814877-59814899 TGGCAGCGCGGCCGGGGCCCAGG + Exonic
908581971 1:65525760-65525782 TGGCGGCGGCGCCGGGGCTCGGG - Intronic
910935095 1:92480846-92480868 TGCCGGCGGCGCGGGGGCCGGGG - Exonic
915309776 1:155001211-155001233 GGGCGGCGCCAGGGGGGCCCTGG - Intergenic
918040753 1:180912768-180912790 AGGCGGCCCCGCGGGGCTCCGGG + Intergenic
918151095 1:181798745-181798767 CGGCGGAGGCGCGGGGGGCCTGG + Exonic
921089664 1:211830704-211830726 TCTCGGCGCCGCCGGGGAACGGG - Exonic
922967912 1:229707308-229707330 TGGGGGCGCTGCAGGAGACCAGG - Intergenic
923744412 1:236686838-236686860 CGGGAGCCCCGCGGGGGACCCGG - Intronic
924026602 1:239839792-239839814 TGGCGGGGCGGGGGGGGAGCGGG + Intronic
1066180458 10:32957511-32957533 TAGTGGAGCCGCTGGGGACCGGG - Intronic
1066180545 10:32957810-32957832 TGCCGGAGCTGCGGGGGACCGGG - Exonic
1068762921 10:60733122-60733144 AGGCGGCGCCGCGAGGCTCCGGG - Intronic
1069024013 10:63521258-63521280 TGGCGGCGGCGCGTTGGCCCGGG - Intergenic
1070032784 10:72692789-72692811 GGGCGGCCCCGCCGGGGTCCTGG - Intronic
1070151993 10:73811097-73811119 TGCGGGCGCCGAGGGGGCCCGGG + Intronic
1070768282 10:79068648-79068670 TGGTGGCGTAGCGGGGAACCAGG + Intergenic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1072654321 10:97319710-97319732 CAGCGGCACCGCCGGGGACCTGG - Exonic
1075459048 10:122603686-122603708 TGGAAGCGCTACGGGGGACCGGG + Intronic
1075459680 10:122607745-122607767 TGGAAGCGCTACGGGGGACCGGG + Intronic
1075460312 10:122611804-122611826 TGGAAGCGCTACGGGGGACCGGG + Intronic
1075460944 10:122615863-122615885 TGGAAGCGCTACGGGGGACCGGG + Intronic
1075728611 10:124623300-124623322 TGGCGGGACCGCGGGGCCCCTGG - Exonic
1075801865 10:125159443-125159465 TCGCGGCGGGGCGGGGGGCCTGG - Intronic
1076329703 10:129655186-129655208 TGGGGGCCCCGCGGAGGGCCTGG + Intronic
1076873413 10:133204534-133204556 TGGCGGTGCCACGGAGGGCCAGG - Intronic
1080503833 11:32893349-32893371 CGGCGGGGTCGCGGTGGACCAGG + Intronic
1081502498 11:43680560-43680582 TGGCGGAACCCCGGGGGACGCGG + Intronic
1083936640 11:65872938-65872960 TGGCGGCGCCGCGGGGGACCGGG - Intronic
1083941900 11:65900349-65900371 TGGCGGCTCTGCGGGGTACACGG + Exonic
1084066136 11:66705368-66705390 TGGCAGCGGCGCGGCGGGCCCGG - Exonic
1085043999 11:73343085-73343107 TGGCGGCGGGGCGGGGGGCGGGG - Intronic
1089346973 11:117796955-117796977 TGGCGGCGAGGCGGGGTGCCCGG - Intronic
1090375166 11:126283163-126283185 GGGCGGGGTCGCGGGGGACCGGG + Intronic
1090676205 11:128999270-128999292 TGGGGGCACCGCAGGAGACCAGG - Intronic
1090788574 11:130070352-130070374 TGGCGGCGCCGCGGGCGGGTTGG - Intronic
1091823256 12:3491746-3491768 CGGCGGCGGCGCGGTGGTCCGGG - Intronic
1095261660 12:40105616-40105638 CGGCGGCGGCGTCGGGGACCTGG - Exonic
1095985662 12:47997809-47997831 TGGTGGGGCCTTGGGGGACCTGG + Intronic
1096035818 12:48469221-48469243 TGGGGGCGCTGCAGGAGACCAGG + Intergenic
1096073565 12:48788930-48788952 GGGCGGCGGGGCGGGGGCCCAGG - Intronic
1096365485 12:51025886-51025908 CGTCGGCGCCGCAGGGGGCCGGG - Intronic
1097288747 12:57896738-57896760 TGGAGGCGACGCGGGGGGTCGGG + Intergenic
1097675914 12:62602758-62602780 TGGCGGCGCGGGGGGCGGCCTGG + Exonic
1098839141 12:75458114-75458136 TGGGGGCGCTGCAGGAGACCAGG + Intergenic
1098948887 12:76618655-76618677 TGGCGGAGCCAGGGGGTACCTGG - Intergenic
1101504104 12:105330772-105330794 TGACGGGGCCGCGAGGGGCCAGG - Exonic
1103989197 12:124786808-124786830 TGGCGGGGCCACCGGGGCCCTGG + Intronic
1104644364 12:130486456-130486478 TGGCGGGGGGGCGGGGGACGGGG - Intronic
1104980215 12:132570243-132570265 TGGGGTCCCCGCGGGGGACGGGG + Intronic
1106036806 13:26051353-26051375 TGGGCGCGCCGCCGCGGACCTGG + Intergenic
1110456961 13:75699867-75699889 TGGGGGCGCTGCAGGAGACCAGG + Intronic
1113335443 13:109372332-109372354 TCGTGACCCCGCGGGGGACCTGG - Intergenic
1113378046 13:109782654-109782676 TGGCGCCGCGGTGGGGGTCCGGG + Exonic
1113378792 13:109785510-109785532 TGCCGGCGCCGCCGGGGCCGAGG - Exonic
1113651590 13:112037183-112037205 TGGTGGAGACGCGGGGGAGCTGG - Intergenic
1116470646 14:45281969-45281991 TGGGGGCGCCACAGGAGACCAGG - Intergenic
1117690434 14:58299452-58299474 GGTCGTCTCCGCGGGGGACCTGG + Intronic
1118312496 14:64704301-64704323 TGGCGGCTCTGCGGGGGCCGGGG - Intronic
1119007800 14:70947967-70947989 TGGGGGCGCTGCTGGAGACCAGG - Intronic
1119500894 14:75126780-75126802 CGGCGGCGGCGCGGCGGAGCAGG - Exonic
1121352406 14:93184438-93184460 TGGCGTCGCCGCTGGGGGCAGGG - Intronic
1121417361 14:93788567-93788589 TGGCGGCTGCGCGGGCGCCCGGG + Intergenic
1121453958 14:94026799-94026821 AGGCGGCGCCCCGGGCCACCTGG - Intronic
1122230973 14:100306235-100306257 AGGCGGCCTCGCCGGGGACCCGG - Exonic
1122277970 14:100604977-100604999 TGGCGGCTCCGAGGGCCACCTGG + Intergenic
1122558127 14:102592439-102592461 GGGCGGCGGGGCGGGGGAGCGGG - Intergenic
1122624127 14:103075547-103075569 TGTCGGCTCCGCGCGGGCCCCGG + Intergenic
1122657663 14:103273294-103273316 GGGCGAGGCCGCGGGGGACCCGG - Intergenic
1122942040 14:104985842-104985864 CGGCGGGGCCGCGCGGGACCAGG - Exonic
1122978564 14:105181092-105181114 CGGCGGGGGCGCGGGGGACGCGG + Intronic
1123036671 14:105474572-105474594 GGGCGGCGCCGCGGTCGCCCGGG + Intronic
1124249325 15:28096852-28096874 TGGCGGCCCCGCGGCAGGCCAGG + Intronic
1127293732 15:57592061-57592083 TGGCGGCGCCGCCCGAGAGCAGG - Exonic
1127789886 15:62390435-62390457 CCGCGGCGCCGCGCGGCACCGGG - Intergenic
1127995696 15:64152108-64152130 TTGCGGCGCCGCGGCTGCCCGGG - Intronic
1128457002 15:67836719-67836741 TGTAGGCACCGCTGGGGACCAGG - Intergenic
1129082480 15:73052677-73052699 TGGCGGCGGAGCGGGGAGCCCGG + Exonic
1129644738 15:77419835-77419857 TGGCGCCGCCGCCGGGGCTCTGG - Intronic
1129769590 15:78194520-78194542 TGGCGGCTCTGCGGGCGAGCAGG + Exonic
1129823644 15:78620585-78620607 TGGCGCCGTCGCCGGGGACTCGG - Intronic
1131144434 15:90002030-90002052 CGGCGGCGGCGCGGGAGGCCCGG + Intronic
1132111595 15:99105711-99105733 TGGCGGCGGCGCGGCGGGGCCGG - Exonic
1132741338 16:1414768-1414790 GGGCGGGGCCGCGGGGGGCGTGG - Intergenic
1132851505 16:2026929-2026951 CGGCGGCGGCGCTGGGCACCCGG - Exonic
1132868010 16:2103383-2103405 TGGCGGAGCTGCGGTGGCCCCGG + Exonic
1134523763 16:14929740-14929762 TGGCGGAGCTGCGGTGGCCCCGG - Intronic
1134711354 16:16328225-16328247 TGGCGGAGCTGCGGTGGCCCCGG - Intergenic
1134948222 16:18340357-18340379 TGGCGGAGCTGCGGTGGCCCCGG + Intergenic
1134955475 16:18380468-18380490 TGGCGGAGCTGCGGTGGCCCCGG + Intergenic
1136625323 16:31458760-31458782 GGGCGGGGCGGCGGGGGAGCGGG - Intronic
1138105624 16:54285951-54285973 CGGCGGCAGCGCGGGGGCCCGGG - Exonic
1138595266 16:58026213-58026235 AGGCGGCTCCGGCGGGGACCGGG + Exonic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1140663990 16:77212429-77212451 CGGGGGCGGAGCGGGGGACCTGG - Intronic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1143026604 17:3944982-3945004 TGGCGGCGCCGAGGTGGCCGTGG - Intronic
1143548487 17:7614520-7614542 TGGCGGCGCCATGGGCGGCCTGG - Exonic
1147134748 17:38428427-38428449 TGGGGGCGCCGGCAGGGACCCGG - Exonic
1147612114 17:41807969-41807991 TGGCGGCGCTGCGGGCAGCCTGG + Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149616745 17:58007217-58007239 TGGAGGGGCCGCGGGAGACGTGG - Exonic
1157867267 18:51197438-51197460 AGGCGGCGGGGCTGGGGACCCGG + Intronic
1158478975 18:57803705-57803727 TGGCGGGGCCGCGGCGCGCCCGG + Intergenic
1158893498 18:61893956-61893978 TGGCGGGGCCGCAGGGTCCCGGG - Intronic
1160706343 19:531910-531932 TGGCGGCGGCGGAGGGGCCCGGG - Exonic
1160810433 19:1010776-1010798 GGGCAGCGCCGTGGGGGTCCCGG + Exonic
1161051610 19:2166846-2166868 TGGGGGCGCCGCAGGGAAGCTGG - Intronic
1161494747 19:4580943-4580965 CGGCTGCGCCGCTGGGGAGCTGG - Intergenic
1161622813 19:5308212-5308234 TGGCAGCGTCGAGGGGAACCAGG - Intronic
1161702980 19:5805108-5805130 GGGCGGCGGCGAGAGGGACCTGG - Intergenic
1162036569 19:7943381-7943403 GGGCGGCGATGCGCGGGACCTGG - Intronic
1162374429 19:10296361-10296383 GGGCGGCGCGGCGGGGGGCGCGG + Exonic
1162932099 19:13962437-13962459 TGGATGCCCCGCGGGGCACCTGG + Exonic
1163235698 19:16029215-16029237 TGGGGGCGATGGGGGGGACCAGG + Intergenic
1163392302 19:17038151-17038173 TGGCGGAGCCGAGGCGGGCCAGG - Intergenic
1164314596 19:24075773-24075795 TGGGGGCGCTGCAGGAGACCAGG + Intronic
1164639217 19:29812251-29812273 GGGCGGCGTCGCGGGGCGCCCGG + Intronic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1165721410 19:38082116-38082138 CGGGGGAGCCGCGGGGGGCCCGG + Exonic
1165851457 19:38852226-38852248 GGGCGGCGCCGCGCGCGGCCGGG - Intronic
1166055374 19:40285108-40285130 TCGCGGCACCGCGGGGGGCCCGG + Intronic
1166250340 19:41565228-41565250 TGGCGGTGCCACAGGGGAGCGGG - Intronic
1166304257 19:41928598-41928620 CGGCGGCGGCGCGGGGGAGGGGG + Intronic
1166517978 19:43461479-43461501 TGGAGGCGCCGCTGGCCACCAGG - Exonic
1166714050 19:44955364-44955386 TGGCGGCGGGGGCGGGGACCCGG + Exonic
1166949398 19:46416535-46416557 GGGCGGGGCCGCGGGAGGCCCGG - Intergenic
1166949450 19:46416698-46416720 TGGGGGCGCCACGGAGGACGAGG + Intergenic
1167056142 19:47112549-47112571 TGGCGGCGGCGGGGGGGTCCCGG + Exonic
1167268247 19:48493874-48493896 CGGCGGGGCCGCGGGGCCCCGGG - Exonic
1168495030 19:56840641-56840663 TGGTGGCGCCGCCGGGCGCCGGG - Exonic
1168573244 19:57487879-57487901 TGGCGGCGCCCAGGGTGGCCCGG + Exonic
1168574662 19:57500019-57500041 TGGCGGCGCCCAGGGTGGCCCGG + Exonic
926043554 2:9693377-9693399 TGGCGGGCCCGCGGGGAGCCCGG - Intergenic
927340566 2:21979252-21979274 TGGGGGCACCACGGGGCACCAGG + Intergenic
929778829 2:44944497-44944519 GAGCGGCGGCGCGGGGGAGCCGG + Intronic
932045513 2:68345117-68345139 TGGCTGCGCTGCGCGGGACATGG - Intergenic
932180748 2:69643825-69643847 GGGCGGCGCGGCGAGGGACCGGG + Intronic
932331485 2:70900630-70900652 TGGGGGCGCCGAGCGCGACCGGG + Exonic
932447216 2:71788274-71788296 TGGCGGCGCAGCAGCGGGCCTGG + Intergenic
938035066 2:128028276-128028298 GGGCGGGGCCGCAGGCGACCCGG + Intergenic
938858563 2:135341807-135341829 TGGGGGCGCTGCAGGAGACCAGG - Intronic
939146900 2:138426290-138426312 TGGGGGCGCTGCAGGAGACCAGG - Intergenic
940883256 2:158968340-158968362 AGGCGCAGCCCCGGGGGACCCGG + Intergenic
943060415 2:183037700-183037722 TGGGGGCGCCGCTGGGAGCCGGG - Intronic
945357209 2:208854909-208854931 TGGGGGCGCTGCAGGAGACCAGG - Intergenic
945879619 2:215312224-215312246 TGGCGGCGGCCGGCGGGACCCGG + Intronic
946843065 2:223837132-223837154 TGGGGATGTCGCGGGGGACCAGG - Intronic
947602615 2:231463962-231463984 GGGCCGCGCCGCGTGGGTCCTGG - Intronic
947605434 2:231482913-231482935 TGGCAGCGCCGCGGCAGCCCGGG + Intronic
947917812 2:233845527-233845549 TGGCGCTGCCCTGGGGGACCTGG + Intronic
948953752 2:241272230-241272252 TGGCGGCGGGGCGGGGGTCTGGG - Intronic
1169345194 20:4823462-4823484 TGGCCGCGCGACTGGGGACCGGG + Intronic
1170026060 20:11890960-11890982 TGAGGGCGCCGCGGGCGAGCGGG + Intronic
1171481911 20:25460760-25460782 GGCCAGCGCCGGGGGGGACCAGG + Intronic
1171810641 20:29742753-29742775 AGGCGGCCCCGCGCGGCACCTGG + Intergenic
1171866075 20:30488344-30488366 AGGCGGCCCCGCGCGGCACCTGG + Intergenic
1172037298 20:32019100-32019122 TGGGGGCGCCGCGGAGGCCCGGG + Exonic
1172188300 20:33045533-33045555 TGGGGGCGCTGCAGGAGACCAGG - Intergenic
1172662120 20:36574675-36574697 TGGCGGGCCCGCGCGGGAGCTGG + Intronic
1172678727 20:36695597-36695619 TGGGGGCGCTGCAGGAGACCAGG - Intronic
1174317284 20:49713145-49713167 CGGGCGCGCCGCGGGGGACTGGG + Intronic
1174386805 20:50192144-50192166 TGCCGGCGCCGCCGGGGGCGGGG - Exonic
1175399482 20:58692601-58692623 GGGCGGCGCCGCTGGAGGCCGGG + Exonic
1176148042 20:63574135-63574157 GGGCGGGGGCGCGGGGGTCCAGG - Intronic
1176234581 20:64048484-64048506 GAGCGGCGCCGCGGGGGGCGCGG + Exonic
1176547284 21:8207443-8207465 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176547642 21:8208534-8208556 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1176555189 21:8251652-8251674 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176555539 21:8252742-8252764 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1176566235 21:8390490-8390512 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176566593 21:8391581-8391603 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1176574109 21:8434676-8434698 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1176574468 21:8435768-8435790 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1176611081 21:8987060-8987082 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1178351165 21:31873728-31873750 CGGCGGCGGCGCGGAGGACGCGG + Exonic
1179358149 21:40681379-40681401 TGCTGGCGCCGCCGGGGACAGGG + Intronic
1179661523 21:42879086-42879108 CCGCGGCGCCGGCGGGGACCGGG - Intronic
1182075855 22:27495037-27495059 TGGCAGGGCCCAGGGGGACCTGG - Intergenic
1182096679 22:27630556-27630578 TGGGGGCGCCGCTGGGCAGCTGG + Intergenic
1183601801 22:38844168-38844190 TGGGGGCGCCGCCGGGGATGCGG + Intergenic
1183739584 22:39662444-39662466 GGGCGGGGCCGAAGGGGACCTGG + Intronic
1184620300 22:45671818-45671840 AGACGGCGCCGCGGGGGAGGGGG - Exonic
1184727487 22:46355400-46355422 TGGGGACGCCGAGGGGCACCTGG - Intronic
1184996335 22:48210038-48210060 TGACGGTGCCGGGGGGCACCCGG + Intergenic
1185020525 22:48372114-48372136 AGGCGGAGGCGCCGGGGACCTGG - Intergenic
1203252157 22_KI270733v1_random:123728-123750 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1203252516 22_KI270733v1_random:124819-124841 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1203260211 22_KI270733v1_random:168811-168833 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1203260572 22_KI270733v1_random:169905-169927 CGGCGGCACCGCGCGGCACCCGG - Intergenic
951857602 3:27215019-27215041 TGGAGGCGCCGGTGGGGAACAGG - Intronic
954421217 3:50420008-50420030 CCGCGTCTCCGCGGGGGACCTGG - Intronic
960702491 3:120451340-120451362 GGGCGGTGCCGTGGGGGGCCCGG + Intergenic
961013168 3:123449019-123449041 GGGCGGCTCGGCGGGGGTCCCGG + Exonic
961539751 3:127591260-127591282 TGGCGGCGCCGCGTGGAGCAGGG - Intronic
961735744 3:129001387-129001409 TGGTGGCGCTGCCGGGGTCCCGG + Intronic
961785370 3:129344050-129344072 TGGAGGCGCTGAGCGGGACCAGG + Intergenic
964622612 3:158732293-158732315 TGGCGGCGCCCGCGGGGTCCGGG - Exonic
968174019 3:196533529-196533551 TGGGGGCGCCGCAGGAGAGCAGG + Intergenic
968396905 4:247363-247385 TGGGGGCGCTGCAGGAGACCAGG + Intergenic
968514786 4:1011526-1011548 TGGCGGCGGGGCGGGGCACGGGG + Intronic
970332935 4:15003478-15003500 TGGCGGCGCCGCGGGGCTGCAGG - Exonic
970456065 4:16226030-16226052 TGGCGCGGCCGCGGGGGCCTCGG + Intronic
975883607 4:78939397-78939419 CGCCAGCGCCGCGGCGGACCCGG + Exonic
976178182 4:82374576-82374598 TGCCGTCGCCGCCCGGGACCGGG + Intergenic
976184110 4:82428981-82429003 CGCAGGCGCCGCGTGGGACCCGG - Intronic
977564532 4:98567802-98567824 TGGTGGCGGGGCGGGGGGCCTGG + Intronic
978384635 4:108167722-108167744 TGGCGGCGGCGGGGGGGACCCGG - Exonic
979122924 4:116926276-116926298 GGGCGGCGGCGCGGGTGGCCTGG - Intergenic
980073286 4:128265715-128265737 TGGGGGCGCTGCAGGAGACCAGG + Intergenic
980930429 4:139177987-139178009 TGGCGGCGCCGAGGGGCGCGAGG - Intergenic
982157212 4:152535268-152535290 CGGCGGGGCCGGGGGGGACCCGG - Exonic
983061509 4:163166479-163166501 TGGCTGCGGCGCCGGGGTCCCGG + Exonic
985727595 5:1524109-1524131 GGCCGGGGCCGCTGGGGACCGGG + Intergenic
986315325 5:6583118-6583140 CCGCGGCGCCGCGCAGGACCCGG + Intergenic
986721191 5:10563019-10563041 TGGCGCAGCCGCTGGGGACCAGG - Intergenic
987373802 5:17217140-17217162 AGGCGGCGCGGCGGGGGAAGGGG + Intronic
989011387 5:36876617-36876639 CGGCCGCGCCGCGCGGCACCCGG - Intergenic
994043492 5:95284236-95284258 TGCCGGCGCCGCCGGGCTCCAGG + Exonic
995733013 5:115265486-115265508 TGCCGGTGCAGCGGGGGACCTGG - Intergenic
998152305 5:139764464-139764486 TGGCGGCGCCGTGGGCAGCCTGG + Intergenic
999956584 5:156709828-156709850 TGGCGGCGTCGGGGGGGAGGGGG - Intronic
1000735405 5:164893224-164893246 TGGGGGCGCTGCAGGAGACCAGG + Intergenic
1001070306 5:168579562-168579584 TGGCGGCGGCTCCGGGGACCGGG - Exonic
1001823041 5:174724743-174724765 TGGGGGCGCCGAGGGGGCCGCGG + Exonic
1002021228 5:176365602-176365624 GGGCGGCGCCGCGGCGGTGCTGG + Exonic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1005826260 6:29633099-29633121 AGGAGGCGGCGCCGGGGACCAGG + Exonic
1006259226 6:32854128-32854150 TGGCGGCGCCGCGAAGGGGCGGG + Intronic
1012400012 6:98835095-98835117 TGGCGGCGGCGGGGGGGGCGGGG + Exonic
1016714109 6:147204120-147204142 TGGCGGCGCCGGGGGCGAGCCGG + Intergenic
1016937253 6:149456612-149456634 GGGCGGCGGGGCGGGGGGCCGGG - Intronic
1019198372 6:170295640-170295662 CGGCTGCGCCGCTGGAGACCCGG + Intronic
1019765160 7:2844354-2844376 GGGCGGCGCCGCGTGAGGCCCGG + Intergenic
1021313485 7:19118287-19118309 TGGCCGCGCCGCGGGGGCTGAGG + Intergenic
1022427951 7:30285543-30285565 CGGCGGCGCCGCGGCGGCCGCGG + Exonic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1023287105 7:38631398-38631420 TGGCGGCGGCGCGGAGGAGCGGG + Exonic
1025028246 7:55535512-55535534 TGGCTGCGGGGCGGGGGACTGGG - Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1025829812 7:65038775-65038797 TGGCGGGGCCGCGAGGCAGCCGG + Intergenic
1025917067 7:65873775-65873797 TGGCGGGGCCGCGAGGCAGCCGG + Intronic
1027151854 7:75738959-75738981 GGGCGGCGCCGTGGGGATCCCGG - Intronic
1027244545 7:76358507-76358529 TGGCAGCGCCGCGGGGCCACGGG + Intronic
1029123184 7:98281702-98281724 CGGCGGGGACGCGGCGGACCGGG - Exonic
1029372418 7:100158199-100158221 GGGCGGCGGCGCCGGCGACCAGG - Exonic
1029896490 7:103989702-103989724 TGGCGGCGGCGGGGGGGACGCGG - Intergenic
1030659719 7:112206365-112206387 TGACTGCGCCGCCGGGTACCCGG - Exonic
1032279172 7:130486951-130486973 TGGTGGCGCGGCTGGGGGCCTGG + Intronic
1033227252 7:139571840-139571862 TGGCGGCGCCGAGGGCCACGCGG + Exonic
1034578932 7:152025942-152025964 CGGCGGCGGCGCGCGGGGCCTGG + Intronic
1035203302 7:157279864-157279886 TGGGGGCGGGGCGGGGGGCCCGG - Intergenic
1035572846 8:685070-685092 TGGGGGCGCTGCAGGAGACCAGG + Intronic
1036454189 8:8893375-8893397 GCGCGGCGCCTCGGGGGGCCCGG + Exonic
1039996875 8:42541732-42541754 ACGCGGCCCCGCCGGGGACCGGG - Intronic
1041552433 8:59118092-59118114 TGCCAGGGCCGCGGGGGCCCGGG - Intronic
1043053245 8:75407428-75407450 TGGCTGCCCCGCGGAGGCCCGGG + Intergenic
1044142288 8:88670892-88670914 TGGGGGCGCTGCAGGAGACCAGG + Intergenic
1049109750 8:140635509-140635531 TGGCGCCGCCGAGGGGCTCCGGG + Exonic
1049620879 8:143597882-143597904 TGGCTGCGGCGGGGGGGACCCGG - Exonic
1049762756 8:144338387-144338409 CGGCCGCGCCGCGCGGGTCCTGG + Intergenic
1049766637 8:144358210-144358232 TGGCCGCGGCGCTGGGGCCCCGG + Exonic
1049789538 8:144466476-144466498 TGGTGGCGCCGCGGCGGCCGCGG + Exonic
1057259946 9:93577495-93577517 TAGCTGCTCCGCGGGGGTCCGGG - Intronic
1057781921 9:98056989-98057011 GGGCGGGGCCGCGGGGAGCCAGG + Intronic
1058413845 9:104764399-104764421 CGGCGGCGGCGCGGGGCCCCAGG - Intronic
1058923527 9:109640480-109640502 TGGCGGCGCGGCGCGGAGCCTGG - Intergenic
1060209096 9:121699477-121699499 GGGCGGCGGCGCGGGGGACCGGG - Intronic
1061559734 9:131394506-131394528 TGGCGGCGCCGCGCGGCCTCAGG + Intronic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1062292515 9:135803167-135803189 TGGCGGTGCCGGGAGGGGCCTGG + Intergenic
1062467406 9:136687365-136687387 TGGCGGCGCCGTCGGGCGCCGGG - Exonic
1062621234 9:137423376-137423398 AGGGGGCGCCGCGGGGCAGCGGG + Exonic
1062646566 9:137551130-137551152 TGGGGGTGCCGCTGGGGACGGGG + Intergenic
1062656340 9:137605976-137605998 CGGCGGCGCCGGGGAGGTCCGGG + Intronic
1203468560 Un_GL000220v1:106878-106900 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1203468919 Un_GL000220v1:107970-107992 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1203476381 Un_GL000220v1:150850-150872 AGGCGGCGGCCCGGGGGATCCGG - Intergenic
1203476740 Un_GL000220v1:151942-151964 CGGCGGCACCGCGCGGCACCCGG - Intergenic
1185766790 X:2732231-2732253 TGTTGGCTTCGCGGGGGACCTGG + Intronic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1188256298 X:27965534-27965556 TGGGGGCGCTGCAGGAGACCAGG + Intergenic
1189341141 X:40205523-40205545 TGGCGGCGCCGAGCGAGTCCCGG + Intergenic
1189557604 X:42161785-42161807 TGGGAGCGCTGCGGGAGACCAGG + Intergenic
1190214002 X:48468337-48468359 AGGGGGTGGCGCGGGGGACCGGG - Intronic
1190279289 X:48918775-48918797 TGGCGGCGGCGTGGGGGTCCCGG + Exonic
1190790082 X:53690966-53690988 TGGCGGGGCGGCGGGGGTCAAGG - Intergenic
1199772250 X:150982833-150982855 TCGCGGCGCCGCGGCCGAACCGG + Intronic
1200231115 X:154444382-154444404 GCGCGGGGCCGCCGGGGACCTGG - Intronic