ID: 1083938624

View in Genome Browser
Species Human (GRCh38)
Location 11:65883262-65883284
Sequence GGACAGAGTGGTCCACAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083938624_1083938636 22 Left 1083938624 11:65883262-65883284 CCAGCTTGTGGACCACTCTGTCC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1083938636 11:65883307-65883329 CAAGTCAGAGGAGGGGATATGGG 0: 1
1: 0
2: 0
3: 15
4: 229
1083938624_1083938633 14 Left 1083938624 11:65883262-65883284 CCAGCTTGTGGACCACTCTGTCC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1083938633 11:65883299-65883321 GGCAGCGTCAAGTCAGAGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 186
1083938624_1083938631 10 Left 1083938624 11:65883262-65883284 CCAGCTTGTGGACCACTCTGTCC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1083938631 11:65883295-65883317 TTTTGGCAGCGTCAAGTCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 102
1083938624_1083938635 21 Left 1083938624 11:65883262-65883284 CCAGCTTGTGGACCACTCTGTCC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1083938635 11:65883306-65883328 TCAAGTCAGAGGAGGGGATATGG 0: 1
1: 0
2: 0
3: 17
4: 234
1083938624_1083938629 -7 Left 1083938624 11:65883262-65883284 CCAGCTTGTGGACCACTCTGTCC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1083938629 11:65883278-65883300 TCTGTCCTGCTGGTGGGTTTTGG 0: 1
1: 0
2: 1
3: 39
4: 494
1083938624_1083938634 15 Left 1083938624 11:65883262-65883284 CCAGCTTGTGGACCACTCTGTCC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1083938634 11:65883300-65883322 GCAGCGTCAAGTCAGAGGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 158
1083938624_1083938632 13 Left 1083938624 11:65883262-65883284 CCAGCTTGTGGACCACTCTGTCC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1083938632 11:65883298-65883320 TGGCAGCGTCAAGTCAGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083938624 Original CRISPR GGACAGAGTGGTCCACAAGC TGG (reversed) Exonic
900298513 1:1964953-1964975 GAGCAGGGTGGTCCACAAGCAGG - Exonic
900318213 1:2069890-2069912 GGACAGGGTGGTCCCCAGTCAGG + Intronic
904934840 1:34122811-34122833 GGACAGAGAGGCCCACTAGAGGG + Intronic
904947663 1:34211359-34211381 GGAGATAGTGGTCAACAAGATGG + Intronic
905341564 1:37281935-37281957 GGAAAGAGTGTTCCAGATGCAGG - Intergenic
909214252 1:72866109-72866131 GGAAAGAATGGACCAGAAGCAGG - Intergenic
913159622 1:116133305-116133327 GGACACTGTGGCCCAAAAGCTGG + Exonic
914373475 1:147051321-147051343 GGGAAGAGTGGTCCCCACGCTGG - Intergenic
916508853 1:165453593-165453615 GGACAGAGTTATCCAAATGCTGG - Intergenic
920440339 1:205976337-205976359 GGACAGAATGTTCCAAATGCAGG - Intergenic
921626778 1:217385998-217386020 GGACAGAGAAGTCCTTAAGCAGG + Intergenic
1063096002 10:2909683-2909705 GGATAGAGTGCTCCAGACGCTGG + Intergenic
1063774865 10:9251430-9251452 GGACAGAGTAGTTCACTATCTGG - Intergenic
1067254607 10:44624577-44624599 GGACAGAGGGGTCTGGAAGCGGG - Intergenic
1068324099 10:55461183-55461205 GGACAGAGTGCTGCAGAAGAAGG - Intronic
1068754494 10:60635870-60635892 GGCCAGGGATGTCCACAAGCAGG + Intronic
1068933037 10:62610914-62610936 TGACAGCCTGGTGCACAAGCAGG - Intronic
1069985140 10:72277809-72277831 GGACAGAAGGGTCCGCAAGTGGG + Intergenic
1070154680 10:73826062-73826084 GGACAGAGTAGGCCACACACAGG + Intronic
1070753184 10:78975918-78975940 GGGAAGAGTGGTCAACAAGCGGG - Intergenic
1072937106 10:99723977-99723999 TGACAGTGAGGTCCACAAGCTGG + Exonic
1076307792 10:129476973-129476995 TGAGAGAGGGGTCCACAGGCGGG - Intronic
1076724043 10:132405124-132405146 GGACAGGGAGCTCCGCAAGCCGG + Exonic
1076851657 10:133096229-133096251 GCACAGAGGGGTGCACAGGCTGG - Intronic
1079658657 11:23014155-23014177 GCACAGTGAGGGCCACAAGCAGG - Intergenic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1081541553 11:44038278-44038300 GGACAGAGTAGCCCAGACGCTGG + Intergenic
1081810037 11:45909471-45909493 GGACAGGGTGGGCCGCAGGCTGG - Intergenic
1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG + Intronic
1083938624 11:65883262-65883284 GGACAGAGTGGTCCACAAGCTGG - Exonic
1085341630 11:75735217-75735239 GGACAGAGTGGCAACCAAGCTGG + Intergenic
1087061785 11:93986067-93986089 GGACTGTGAGGTCCATAAGCAGG - Intergenic
1089183517 11:116598981-116599003 GGACAGAGTGGTGAACAACATGG - Intergenic
1089554056 11:119305273-119305295 GGACAGGCTGGCCCACAAGAGGG - Exonic
1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG + Intronic
1093337117 12:17920125-17920147 GGACAGAGTGGGGCACCAACAGG + Intergenic
1093623788 12:21322967-21322989 GGACAGGGTGGATCTCAAGCAGG - Intronic
1094015175 12:25855168-25855190 GGACAGAATTGTCATCAAGCAGG + Intergenic
1096576804 12:52557888-52557910 GGCCAGAGGGCTCCCCAAGCAGG - Intergenic
1097026100 12:56056726-56056748 AGACAGAGTGGTCAAGAAGGGGG - Intergenic
1099097523 12:78393322-78393344 GGACACAATGCTGCACAAGCAGG - Intergenic
1100668643 12:96785235-96785257 AGAAAGAGTGGTCCAGTAGCCGG + Intronic
1103991488 12:124802436-124802458 GGACAGTGTCCTCCACAATCTGG + Intronic
1109660837 13:65458461-65458483 AGACAGAGGGGTGCACAAGTGGG + Intergenic
1113045111 13:106147117-106147139 GGACAGAGTCGTGCAGAAGTAGG + Intergenic
1115099900 14:29686213-29686235 GGAGAGAGTGCTCCACAATTTGG + Intronic
1115135904 14:30107614-30107636 GGACAGATTGTTCCTCAAGTGGG + Intronic
1120282239 14:82454246-82454268 GGAAAGTGTGGTCCCCAAGGTGG + Intergenic
1121331618 14:93053180-93053202 AGACAGAGGGGCTCACAAGCAGG + Intronic
1122891384 14:104733744-104733766 GGACAGAGTGGGCCCCAAAAGGG + Intronic
1125712919 15:41801358-41801380 GAACAGAGTGAGCCAGAAGCAGG - Intronic
1132692460 16:1187687-1187709 GGTCAGAGTGGCCCCCAAGCAGG - Intronic
1133289163 16:4706945-4706967 GGACAGAGTGGCCCACGTTCAGG - Intronic
1134143266 16:11740901-11740923 GGAAACAGTGGTTCCCAAGCAGG + Intronic
1134220508 16:12350073-12350095 GCACAGGGTGGCCCACAAACTGG - Intronic
1135181583 16:20279216-20279238 GGACAAAGTGGGGCACATGCAGG - Intergenic
1135435031 16:22420950-22420972 GGACCGGGTGGTCCACAAGGTGG + Intronic
1136578265 16:31137013-31137035 GGCCAGAGTGGCCCTCAAGGAGG - Intergenic
1138371778 16:56532795-56532817 GGACAGGATGGTCCAGAAGCCGG - Intergenic
1138493826 16:57394732-57394754 GGAGAGATTGGGCGACAAGCAGG - Intergenic
1138689460 16:58753916-58753938 GAACACAGTGGTGCCCAAGCAGG + Intergenic
1142756503 17:2019425-2019447 GGACAGAGCGGTTCACTTGCTGG - Intronic
1145238906 17:21228138-21228160 GGAGAGAGTGGCCCCCAGGCAGG - Intergenic
1150774074 17:68065201-68065223 AGACAAAGGTGTCCACAAGCAGG - Intergenic
1151365839 17:73615697-73615719 AGACAGAGTGATGCACAAGCTGG + Intronic
1152303661 17:79509213-79509235 GGACAGCGGGGTCCCCAAGGCGG + Intronic
1152456463 17:80419664-80419686 GGACAGTGTGGTCAAGGAGCAGG - Intronic
1152741521 17:82020498-82020520 CGCCAGCGTGGTCCACAGGCTGG + Intronic
1152969155 18:144374-144396 GGACAGAGTGTTATCCAAGCTGG - Intergenic
1161021946 19:2014934-2014956 GGACAGAGAGGTGCAGAGGCAGG + Intronic
1161047732 19:2145281-2145303 GCACAGAGTGGGCCACATGGTGG + Intronic
1162739510 19:12766047-12766069 GGACAGAGGGGGCCAAAAGTGGG - Intronic
1163384664 19:16992196-16992218 GGACAGAGAGGTCTCCAAACTGG - Intronic
1163520232 19:17787757-17787779 CGACAGAGTGGTCCCCTCGCTGG - Exonic
1165930036 19:39351592-39351614 GAAAAGAGTGGGCCACAAGGGGG + Intronic
926247737 2:11133236-11133258 GGACAGAGTGTTCCAGGAGGAGG + Exonic
926884555 2:17585254-17585276 GGAGGGTGTGGACCACAAGCTGG - Intronic
927397164 2:22665777-22665799 GGACAGAGTTTTCCGCAAGTAGG - Intergenic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
935096788 2:99952476-99952498 GGACAGAGGGGTCTGCAAGAGGG - Intronic
936640211 2:114303784-114303806 GGACAGACTGCTCCTCAAGTAGG - Intergenic
943932233 2:193868617-193868639 TGAAAGAGTGGTAAACAAGCAGG + Intergenic
945772798 2:214066060-214066082 GGAAGAAGTGGTCAACAAGCTGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947265272 2:228272690-228272712 GGACTGAGTGGTGAACAACCAGG - Intergenic
948341435 2:237255915-237255937 GGACAGAGCAGTGCACAAGGAGG - Intergenic
948462510 2:238137181-238137203 GGACAGTGTGGGACACGAGCAGG + Intergenic
1169080654 20:2796215-2796237 GGACAGAGTGGCCCTCATGCTGG + Intronic
1171086904 20:22246028-22246050 AGACATAGTGGTCCCCAAGCTGG - Intergenic
1171120381 20:22563543-22563565 GGACTGTGTGCTTCACAAGCTGG - Intergenic
1171323899 20:24273641-24273663 GAAAAGAGTGGTTCCCAAGCAGG - Intergenic
1171428749 20:25065354-25065376 GGACAGGGTGGGCTACCAGCAGG - Intergenic
1173159481 20:40641773-40641795 GCACAGAGTGGCTAACAAGCAGG - Intergenic
1174093014 20:48064632-48064654 GGAAAGAGTGGCCCCCTAGCAGG - Intergenic
1175288459 20:57855259-57855281 GGACAGACAGGTCAAGAAGCTGG - Intergenic
1178398979 21:32267062-32267084 GGACAGGGTGGCCCACAACAGGG + Intergenic
1179355322 21:40653379-40653401 GGAGAGGGTGGTCCACAGCCAGG + Intronic
1184556576 22:45236453-45236475 GGACAGCGTAGTCTTCAAGCAGG - Intronic
1185250527 22:49799395-49799417 GGACAGAGGCCTCCGCAAGCTGG + Intronic
950329218 3:12143077-12143099 TGACAGAGAGGCCCAAAAGCAGG + Intronic
953263158 3:41359507-41359529 GGAGAGAGTGTTCCTGAAGCAGG + Intronic
954816449 3:53285141-53285163 GGACAGAGTGGTCTAAATGCAGG + Exonic
955505122 3:59624925-59624947 AGACAGAGTTGTCCAAATGCAGG + Intergenic
961660542 3:128466511-128466533 GGACACAGTGGTGGACATGCTGG + Exonic
965900604 3:173636405-173636427 GGAAACCGAGGTCCACAAGCTGG + Intronic
966829092 3:183990399-183990421 ACAAAGAGTGGTCCATAAGCTGG - Intronic
966902157 3:184494329-184494351 GGAAAGAAAGGGCCACAAGCAGG - Intronic
967040698 3:185689503-185689525 GGGAAGAGTGGTCCCCACGCTGG + Exonic
967299292 3:187996819-187996841 GAAAAGACTGGTCCACATGCAGG + Intergenic
977755982 4:100672746-100672768 GGTCCGTGTGATCCACAAGCAGG + Intronic
978261249 4:106762575-106762597 TGAAAGATTGGTCCACAAGTGGG - Intergenic
988261659 5:28894390-28894412 GGAGAGAGAGTTCCTCAAGCAGG - Intergenic
988892079 5:35628879-35628901 GTAAAGAGTAGTCCAGAAGCGGG - Intronic
993597515 5:89877736-89877758 CGACAGAGTCGTACTCAAGCAGG + Intergenic
994405922 5:99345075-99345097 GGGCAGACTGGTCCTCAAGTGGG - Intergenic
998522570 5:142814071-142814093 GGACAGTGTTATCCACAAGTAGG + Intronic
1001648267 5:173297896-173297918 AGACAGAGTGGGCTCCAAGCAGG + Intergenic
1004311306 6:14547839-14547861 GTTCAAAGTGCTCCACAAGCTGG - Intergenic
1006593142 6:35172729-35172751 GGAGACAGTGCTCCACAGGCAGG + Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1008983821 6:57518481-57518503 GGAGATAGTGGTACACAAGATGG - Intronic
1015415546 6:132943889-132943911 GGACAGAGTGGTTGCCCAGCAGG - Intergenic
1018145769 6:160886799-160886821 TGACACAGTGGTCCATATGCTGG - Intergenic
1018231153 6:161676809-161676831 GGACAGGGTGAGACACAAGCAGG + Intronic
1018836131 6:167485517-167485539 GGACAGTGTGGGCCCTAAGCAGG - Intergenic
1018908925 6:168090834-168090856 GGACAGAGTAGCCCCCAAGAGGG - Intergenic
1019438051 7:1031859-1031881 GGGCAGAGTGGTCCAGGTGCGGG + Intronic
1020137480 7:5594913-5594935 GGAAAGAGTGGCGCACAGGCCGG - Intronic
1020946181 7:14610699-14610721 GCACAGAGTTGTCCACTAGTAGG - Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024058684 7:45682545-45682567 GCACAATGTGGTCCACAAGGTGG + Intronic
1024200059 7:47097466-47097488 GGATAGAATGGTCAACAAGTTGG - Intergenic
1024511750 7:50209977-50209999 GCACCGAGGGGTCCACAGGCAGG - Intergenic
1024867430 7:53919953-53919975 GGACAGTGTTGTTTACAAGCAGG + Intergenic
1025028901 7:55539743-55539765 GGACAGAGGTGGCCACAGGCAGG + Intronic
1027223048 7:76226218-76226240 GGACACAGTGGGCCACAAACTGG - Intronic
1032186848 7:129734058-129734080 GGTCAGAGAGCTCCACAAGTGGG - Intronic
1033601826 7:142894075-142894097 GGACAGAGAGACCCAGAAGCAGG + Intergenic
1037459591 8:19095484-19095506 GGAGAGAATGGGCCACAGGCAGG + Intergenic
1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG + Intergenic
1037625160 8:20600236-20600258 GGCCAGATGGGTCCACATGCAGG - Intergenic
1038854948 8:31320956-31320978 GGACAGAGAGGCAGACAAGCTGG + Intergenic
1039254891 8:35708187-35708209 GCACAGAGTGCTCCATGAGCAGG + Intronic
1039979226 8:42392165-42392187 GGAAAGTGCGGTCCACACGCCGG - Intronic
1044090679 8:87996420-87996442 GGTCAGTGTGGTCCAGCAGCAGG - Intergenic
1044481863 8:92699819-92699841 GGCCAGAGTGGCCCACAGCCGGG - Intergenic
1044773158 8:95658954-95658976 TGAAAGAGTGGGCCACAGGCAGG - Intergenic
1046503375 8:115107512-115107534 GGACAGAGTGTTGCAATAGCTGG + Intergenic
1047593933 8:126357330-126357352 GGACAGAGTGGCTGACAAGGTGG + Intergenic
1047597380 8:126392553-126392575 GGGCAGAGTGGTCACCAAGCAGG - Intergenic
1050305140 9:4299055-4299077 GGGCAGAGGGGTACACAATCAGG - Intronic
1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG + Exonic
1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG + Intergenic
1055155083 9:73052924-73052946 TGACAGAGTTGACCATAAGCAGG - Intronic
1056629115 9:88278116-88278138 GGACAGGCGGGACCACAAGCCGG - Intergenic
1057492691 9:95534217-95534239 TGACAGAGTGGCCCACTAACAGG - Intergenic
1059468639 9:114486311-114486333 GGACAGAGTCAGCCACAATCTGG - Intronic
1059623934 9:116040440-116040462 GGACAGGGTGGTCCAGGAGGAGG + Intergenic
1061231095 9:129316234-129316256 GGGCAGAGTGGCCCATGAGCTGG + Intergenic
1061273549 9:129557400-129557422 GGACAGGGTGGTCCAGGAGCAGG + Intergenic
1061408892 9:130407659-130407681 GAACAGAGTGGGCCGCACGCAGG + Intronic
1061666907 9:132165580-132165602 GAACAGAGTGCTCCACGTGCTGG - Intronic
1061801131 9:133113973-133113995 GGACAGAGGTGTCCCCAGGCAGG + Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1190243205 X:48673830-48673852 GAAGAAAGTGGTCCAAAAGCTGG + Intergenic
1190393348 X:49954652-49954674 GGACTGAGTGGTCTACACACAGG + Intronic
1190750550 X:53358081-53358103 GGCCAGAGAGGTCCAGCAGCTGG - Intergenic
1190752763 X:53376447-53376469 GGACAGTGTGGTTCCCAAACTGG - Exonic
1190928019 X:54925992-54926014 TGACAGAGTGGTTCTCAAGGAGG + Intronic
1191097373 X:56688083-56688105 GGACAGACTGCTCCTCAAGTGGG - Intergenic
1192379933 X:70605153-70605175 GGAAAGAGTGGTCCATAGGAAGG + Intronic
1195299799 X:103517062-103517084 GGACAGAGTGGTTGACATGCAGG - Intronic
1197272340 X:124438448-124438470 AGACTGAGTGGTTCAAAAGCAGG + Intronic
1198660742 X:138965345-138965367 GGATACAGTGGTGCACAAGATGG - Intronic
1198929874 X:141843576-141843598 GAACAGAATGCTCCTCAAGCAGG + Intronic
1199968478 X:152840768-152840790 GGACAGACTGCTCCTCAAGTGGG - Intronic
1201329565 Y:12803297-12803319 GGACACAGTGGTGCTCAAGGTGG - Intronic
1201599466 Y:15712427-15712449 GCACATATTGGTCCACAAGCTGG + Intergenic
1201800736 Y:17952397-17952419 GGACATGGTGGTGCACAAGATGG + Intergenic
1202360515 Y:24104914-24104936 GGACATGGTGGTGCACAAGATGG + Intergenic
1202510263 Y:25565204-25565226 GGACATGGTGGTGCACAAGATGG - Intergenic