ID: 1083940187

View in Genome Browser
Species Human (GRCh38)
Location 11:65891442-65891464
Sequence CCCGAGGTCCACAGCGGTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083940187_1083940195 7 Left 1083940187 11:65891442-65891464 CCGGGACCGCTGTGGACCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1083940195 11:65891472-65891494 CGCCGTCCTGGCTGCGCAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 192
1083940187_1083940200 16 Left 1083940187 11:65891442-65891464 CCGGGACCGCTGTGGACCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1083940200 11:65891481-65891503 GGCTGCGCAGGAGGGGCCGCTGG 0: 1
1: 0
2: 6
3: 50
4: 450
1083940187_1083940198 9 Left 1083940187 11:65891442-65891464 CCGGGACCGCTGTGGACCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1083940198 11:65891474-65891496 CCGTCCTGGCTGCGCAGGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 170
1083940187_1083940194 4 Left 1083940187 11:65891442-65891464 CCGGGACCGCTGTGGACCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1083940194 11:65891469-65891491 GGACGCCGTCCTGGCTGCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 120
1083940187_1083940192 -5 Left 1083940187 11:65891442-65891464 CCGGGACCGCTGTGGACCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1083940192 11:65891460-65891482 TCGGGACCTGGACGCCGTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1083940187_1083940196 8 Left 1083940187 11:65891442-65891464 CCGGGACCGCTGTGGACCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1083940196 11:65891473-65891495 GCCGTCCTGGCTGCGCAGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 154
1083940187_1083940201 21 Left 1083940187 11:65891442-65891464 CCGGGACCGCTGTGGACCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1083940201 11:65891486-65891508 CGCAGGAGGGGCCGCTGGCATGG 0: 1
1: 0
2: 1
3: 29
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083940187 Original CRISPR CCCGAGGTCCACAGCGGTCC CGG (reversed) Exonic
900204899 1:1427548-1427570 CCCCAGGTCCACCCCGCTCCGGG + Exonic
900994215 1:6111717-6111739 CCCGAGGTCCACGGAGGAACGGG + Intronic
913196424 1:116460123-116460145 CCCGAGGCCCTCATCTGTCCTGG - Intergenic
1063077148 10:2728989-2729011 CCTGACGTCCCCAGAGGTCCAGG + Intergenic
1067087265 10:43249553-43249575 CCCCAGGCACACAGCGGTGCAGG + Intronic
1069780576 10:70952929-70952951 GCAAAGGTCCTCAGCGGTCCAGG + Intergenic
1074502795 10:114042108-114042130 ACCGACTTCCACAGCTGTCCAGG - Intergenic
1075088757 10:119431197-119431219 CCTGGGGCCCACAGCTGTCCTGG - Intronic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1081866546 11:46363492-46363514 GCCCAGGTCCACATCTGTCCAGG - Intronic
1083940187 11:65891442-65891464 CCCGAGGTCCACAGCGGTCCCGG - Exonic
1085272476 11:75278472-75278494 CCCAAGGACCACAGGGGTCAGGG - Intronic
1092294943 12:7190053-7190075 CCCGTGGTCCCCCGGGGTCCAGG + Intronic
1096180472 12:49547890-49547912 CCCAAGATCCACAGAGGTCCTGG - Intronic
1096254644 12:50055718-50055740 ACCGAGGTCCAGAGAGGTCAAGG + Intergenic
1112461367 13:99606480-99606502 CCCGAGGTCAACTGCCCTCCCGG - Intergenic
1112590570 13:100760381-100760403 CCTGAGGTCCTCAGCAATCCAGG + Intergenic
1112653656 13:101425327-101425349 CCAGAGTTCCCCAGAGGTCCAGG + Intergenic
1113811295 13:113144136-113144158 CCCGAGGTGCACAGCGGGACAGG - Intronic
1119547493 14:75482774-75482796 CCCAAGTTCCACAGGGGCCCTGG + Intergenic
1122694010 14:103544189-103544211 CACTAGGTCCACAGCTGCCCAGG + Intergenic
1123787405 15:23687138-23687160 TCCGAGGTGCACAGCAGCCCTGG - Exonic
1127017737 15:54708065-54708087 TCTGAGGTCCACAACGGCCCTGG - Intergenic
1132331527 15:101015370-101015392 CCAGAGGTCGCCAGCGCTCCGGG + Exonic
1132981317 16:2739897-2739919 CCCCAGGTCCAGAGGGGCCCTGG - Intergenic
1133162281 16:3920202-3920224 CCCCAAATCCACAGCAGTCCTGG - Intergenic
1139884453 16:70198517-70198539 CCCTTGGTGCTCAGCGGTCCTGG + Intergenic
1142479353 17:208619-208641 CCCTAGGTCCACACCCGACCTGG - Intergenic
1148774610 17:50088392-50088414 CCCGAGCCCCACAGCTGGCCGGG + Intronic
1151703925 17:75757042-75757064 CCCGAAGCCCTCAGTGGTCCTGG - Exonic
1152131943 17:78482859-78482881 CCCTAGGTCCACATCTGCCCTGG - Intronic
1161052898 19:2174352-2174374 CCCAAGGTCCACACAGGCCCTGG - Intronic
1166459038 19:42969728-42969750 CTCCAGTTCCACAGGGGTCCAGG + Intronic
1166475981 19:43125004-43125026 CTCCAGTTCCACAGGGGTCCAGG + Intronic
1167360147 19:49025757-49025779 ACCCAAGTCCACAGCAGTCCAGG + Intronic
1167360939 19:49030024-49030046 AACCAAGTCCACAGCGGTCCGGG - Intronic
1167362714 19:49038773-49038795 ACCCAAGTCCACAGCAGTCCAGG + Intergenic
1167363423 19:49042416-49042438 ACCTGAGTCCACAGCGGTCCGGG - Intergenic
1167365072 19:49050511-49050533 ACCCAAGTCCACAGCGGTCCCGG + Intergenic
1167539602 19:50076892-50076914 CCCGAGTTGCAAAGCGGTCTGGG + Intergenic
1167630110 19:50620979-50621001 CCCGAGTTGCAAAGCGGTCTGGG - Intergenic
1167741848 19:51328696-51328718 CCCGAGGCCCCCAGGGCTCCTGG + Exonic
1168145484 19:54418164-54418186 CCAGAGGCCCACAGTGGCCCAGG - Intronic
926427834 2:12755445-12755467 CCAGAAGTCCACATGGGTCCTGG + Intergenic
927971214 2:27307212-27307234 CCCCAGGACCTCAGAGGTCCCGG - Exonic
928568183 2:32575046-32575068 ACCAAGGTCCACAGCTGACCCGG - Intronic
935634717 2:105241742-105241764 CCAGAGGTCCACAGACATCCAGG + Exonic
1169468533 20:5863057-5863079 CCAGAAGTTCTCAGCGGTCCAGG - Exonic
1175388005 20:58609421-58609443 CCTGAGGTTCAGAGAGGTCCAGG - Intergenic
1176869902 21:14076057-14076079 CCCGGGGTCCACAGAAGGCCTGG - Intergenic
1177426211 21:20925632-20925654 CCAGAGGTACAAAGAGGTCCTGG + Intergenic
1177757596 21:25366514-25366536 CATGAGGACCACAGCGGTCTTGG + Intergenic
1179643132 21:42760188-42760210 CCAGAGGTCAACAGTGTTCCAGG - Intronic
1181329080 22:22075148-22075170 CCTGAGGTCCACAGCCGTAGTGG - Intergenic
1181439353 22:22927794-22927816 CCCGAGTCCCACAGCTGCCCAGG + Intergenic
1184138899 22:42566161-42566183 CCCGACGTCCTCAGCTGCCCAGG - Intronic
1184561805 22:45268232-45268254 CCCGAGCTCCAAAACCGTCCTGG + Intergenic
950072721 3:10165188-10165210 GCCGAGGTCCGCGGCGGACCCGG - Intronic
954636859 3:52075680-52075702 CCAGAGGTCCCCAGTGGGCCGGG - Exonic
954877192 3:53809928-53809950 CCAGAGGTTCTCAGAGGTCCGGG - Intronic
955329988 3:58039462-58039484 CCAGAGGTTCACAGCTGACCAGG + Intronic
955405974 3:58626040-58626062 CCTGAGGTCCAGAGGGGTTCAGG + Intronic
964320870 3:155495663-155495685 CCTGAGGACCACAGGGGCCCTGG - Intronic
964710501 3:159666870-159666892 CCCGATGTCTACATCGGTCAAGG + Intronic
968904219 4:3444174-3444196 TCGGAGGTCCGCAGGGGTCCAGG + Intronic
969721648 4:8895561-8895583 CCCCAGGTCCACAGCAGCGCAGG + Intergenic
971925415 4:33003656-33003678 CCAGAGGTACAAAGAGGTCCTGG + Intergenic
973613452 4:52658399-52658421 CCCTAGGTCTACAGCGGATCAGG + Intronic
985641076 5:1063759-1063781 CACGAGGCCCACAGCCCTCCCGG + Intronic
985727597 5:1524111-1524133 CCCCCGGTCCCCAGCGGCCCCGG - Intergenic
991520854 5:67495225-67495247 CCTGAGGTCCACAGAGATCATGG + Intergenic
999141098 5:149362683-149362705 CCCGAGGTCCAAAGTGCTGCTGG - Exonic
1002340830 5:178515678-178515700 CCCTAGGTCTACATCTGTCCCGG + Intronic
1003038325 6:2664366-2664388 TCCGAGGACCACAGCCCTCCAGG + Exonic
1014029202 6:116681487-116681509 CCCCAGGGCGACAGCGGTCGCGG + Intronic
1017954382 6:159166907-159166929 CCCGGGGTCTACAGCAGTGCTGG + Intergenic
1018768414 6:166952122-166952144 CCCGTGGTCCTCTGCGTTCCTGG - Intronic
1019291253 7:251605-251627 CCCCAGGTCCTCAGCAGGCCAGG + Intronic
1019534967 7:1523995-1524017 CCCCAGGACCCCAGCGGTGCAGG - Intergenic
1023302665 7:38790727-38790749 CCCAGGATCCACAGGGGTCCTGG + Intronic
1024993814 7:55255687-55255709 CCCGCGGTCCGCCGCGTTCCAGG - Intronic
1029110675 7:98211711-98211733 CCCCATGTCCGCAGCGGTTCTGG + Intronic
1034502736 7:151461356-151461378 CCCGAGGTCCAGAGAGGTCAAGG - Intergenic
1038751696 8:30302019-30302041 CCCGTTTTCCACAGGGGTCCAGG + Intergenic
1039493731 8:37965987-37966009 CACCAGGACCACAGCTGTCCGGG + Exonic
1045033675 8:98161442-98161464 CCCCAGTTTCACAGCGGTTCTGG + Intergenic
1049289188 8:141792458-141792480 CCCCAGGGCCACAGTGGGCCGGG + Intergenic
1049726644 8:144149544-144149566 CCCAGGGTCCACAGAGGCCCAGG + Intronic
1053149333 9:35732688-35732710 CCCGAGGCCTACAGCTGGCCTGG + Exonic
1053214303 9:36258180-36258202 CCCGAGGCCCACACTGGACCCGG - Intronic
1059429771 9:114243134-114243156 CCTGAGGACTACAGGGGTCCCGG - Intronic
1062027222 9:134346192-134346214 CCCTAGGACCACAGCGGAACAGG - Intronic
1062696277 9:137877816-137877838 GGCGAGGTCCGCTGCGGTCCCGG + Exonic