ID: 1083941158

View in Genome Browser
Species Human (GRCh38)
Location 11:65896664-65896686
Sequence TGCCCAAGGCTGAAAGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083941158 Original CRISPR TGCCCAAGGCTGAAAGTGAT AGG (reversed) Intronic
901032660 1:6316832-6316854 GTCCCAAACCTGAAAGTGATTGG + Intronic
901141942 1:7040689-7040711 TGGCCAAGGCAGAAAGTCCTAGG - Intronic
901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG + Intronic
903928881 1:26850866-26850888 TGCCCAAGGCTCTTTGTGATTGG + Intronic
904202940 1:28833426-28833448 TGGGCAAGTCTGAAAGTGGTAGG + Intronic
904358413 1:29956632-29956654 TCCCCAAGGAAGAAAGAGATTGG + Intergenic
904600646 1:31670933-31670955 TGGGCAAGGCTGAAAGAAATGGG - Intronic
904768645 1:32869247-32869269 GGTCCAAGGCTCAAAGTGATGGG + Intronic
905648863 1:39643277-39643299 TGGACAAGGCAGAAAGTGGTTGG - Intergenic
905928157 1:41766811-41766833 TCCACAAGGCTGAGAGTGTTTGG - Intronic
908009206 1:59758555-59758577 TGCCCAAGGAAGAAAGAGATGGG + Intronic
910650891 1:89565783-89565805 TGCCCAGAGCTCAGAGTGATCGG - Intronic
910863897 1:91769718-91769740 TGTTCAAGCCTGAGAGTGATCGG - Intronic
911539691 1:99144060-99144082 TGTCCAAGGCTTAAAGTCACTGG - Intergenic
914880937 1:151546531-151546553 TGCCTAGGGCTGAGAGAGATTGG - Intronic
915137192 1:153740897-153740919 TGCCCAAGGCTCCAAGAGATAGG - Intronic
916443926 1:164854628-164854650 TGCCTAAGGCTGGAAGCCATAGG - Intronic
919303306 1:195798264-195798286 AGCTCAAGGCTGAAAGTGCCTGG + Intergenic
919620035 1:199854111-199854133 TGCCCAAGAGTGAAATTGCTAGG + Intergenic
922115653 1:222611051-222611073 TGCCCAGGGCTGGAAGAGGTGGG - Intergenic
922318842 1:224466614-224466636 TGCCCAAGGGTGCAATTGCTGGG + Intronic
923903811 1:238360009-238360031 TGCCTAAGGCTGGGAGGGATGGG - Intergenic
1069463661 10:68618482-68618504 AGCCCAATGCTGAAAGTCAATGG + Intronic
1069799469 10:71073113-71073135 TGCCCAAGGCAGAGAGGGAGGGG - Intergenic
1072488668 10:95881516-95881538 TGCCCAAGAGTGAAACTGTTGGG + Intronic
1075309519 10:121401423-121401445 TGCCCAAGGGTGTAATTGCTAGG - Intergenic
1076327958 10:129643146-129643168 GGCCCAAGGATGAAGGTGAAGGG - Intronic
1077402094 11:2363995-2364017 TGGCCAAGAGTGAAAGTGATGGG + Intergenic
1078490995 11:11768569-11768591 TGGGAATGGCTGAAAGTGATGGG - Intergenic
1078615955 11:12866604-12866626 GGCCCAGGGCTGAAAGTCAGGGG - Intronic
1079268699 11:18960938-18960960 TCCCCTAGGCTGAAAGGGACAGG - Intergenic
1079648004 11:22891620-22891642 TGCCCAAGGCTGGTAGTTATTGG + Intergenic
1080384354 11:31802499-31802521 TGACCCAGGTTGAAAGAGATAGG + Intronic
1082676057 11:56104294-56104316 TCCCCAAGGGTGAAATTTATTGG + Intergenic
1083941158 11:65896664-65896686 TGCCCAAGGCTGAAAGTGATAGG - Intronic
1088456770 11:110041147-110041169 TGCCCAAGGTCAAGAGTGATGGG + Intergenic
1095239730 12:39843131-39843153 TGCCCAAGGGTGGAATTGCTGGG + Intronic
1097333716 12:58359210-58359232 TGTCCAAGGGCTAAAGTGATAGG - Intergenic
1098921579 12:76306905-76306927 TACCCAAGGCTGGAAGACATAGG + Intergenic
1100995578 12:100297111-100297133 AGCCCAAGGCCTAAAGTGTTAGG + Intronic
1102468533 12:113145065-113145087 TGCCCAAGAGTGAAATTGTTGGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104579808 12:130002898-130002920 TCCCCCAGGCTGAAAGGGCTGGG - Intergenic
1105605810 13:21925780-21925802 TGCCCAAGGCAGGGAGTGCTTGG + Intergenic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1108418211 13:50222232-50222254 TACCAAAGGCAAAAAGTGATGGG + Intronic
1109112497 13:58339720-58339742 TGCTCAATGCTGAAAGTAAAGGG + Intergenic
1110842516 13:80158668-80158690 TGCCTAAGTTGGAAAGTGATAGG - Intergenic
1113900658 13:113794993-113795015 TGGCCAGGGCTGGAAGTCATAGG + Intronic
1114632129 14:24165833-24165855 TGACCAAGTCTGAAAGAGAAAGG - Exonic
1119382356 14:74237359-74237381 TGCCAGAGGCTGAAGGTGAAGGG - Intergenic
1120558664 14:85962146-85962168 TGCCCAAGGTCACAAGTGATAGG - Intergenic
1121266669 14:92607649-92607671 TGCCCAAGAGTGAAATTGCTGGG - Intronic
1121661003 14:95635095-95635117 TGAGCATGGCTGGAAGTGATTGG - Intergenic
1123508904 15:20975361-20975383 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123566126 15:21549110-21549132 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123602386 15:21986397-21986419 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1124818677 15:33020972-33020994 TGGCCAAGGCTTAAAGCCATAGG - Intronic
1126370330 15:47939139-47939161 AGCCCAAGGAGGAAAGTGAAAGG + Intergenic
1126557055 15:50000208-50000230 TGCCCAGGGGTGAAATTGTTGGG + Intronic
1126798558 15:52280315-52280337 GGCCCAGGGCTGAGACTGATAGG - Intronic
1128548263 15:68581542-68581564 GGCCCAAGGATGGAAGTGACTGG - Intronic
1128598361 15:68974454-68974476 TGCCCAAGACTGCAATTGTTGGG + Intronic
1128793889 15:70451003-70451025 TGCGCAAGGCTGACAGGAATAGG + Intergenic
1202974493 15_KI270727v1_random:276200-276222 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1134823464 16:17265620-17265642 TGCCCAAGGTTGAATGGGAATGG - Intronic
1134868849 16:17633261-17633283 AGCCGAAGGCTAAAAGTGCTTGG - Intergenic
1139507997 16:67409178-67409200 TCCCCAAGGCTGTAAGTGGCGGG - Intronic
1142942566 17:3394965-3394987 TACAGAAGGATGAAAGTGATGGG + Intergenic
1151144404 17:72027495-72027517 TGCCCAGGGCTCGAAGTGTTGGG + Intergenic
1151175400 17:72284103-72284125 TGGCCACGCCTGAGAGTGATTGG + Intergenic
1153419706 18:4891651-4891673 TGCCAAAGGCTCAAAGGGAATGG + Intergenic
1157629699 18:49081874-49081896 AGCCCAAGGCTGAAAGTGTCAGG + Intronic
1162670508 19:12253571-12253593 TGCACAAGGCAAAATGTGATAGG + Intronic
1163224697 19:15949872-15949894 TTCCTTAGGCTGAAAATGATTGG - Exonic
1164788225 19:30954446-30954468 TGGCCTTGGCAGAAAGTGATAGG - Intergenic
1165026034 19:32962146-32962168 TGTCGAAGGAGGAAAGTGATTGG + Intronic
1165678606 19:37752580-37752602 TGCCAGAGGCTGAGAGTGAGAGG + Intronic
1167876506 19:52418231-52418253 TGCCTCAGCCTGAAAGTGCTAGG + Exonic
1168398707 19:56070392-56070414 TACCAGAGGCTGAAAGTGATGGG + Intergenic
926101106 2:10118714-10118736 AGCCTAAGGCTAAAAGTTATTGG - Intergenic
927104852 2:19814819-19814841 ATCCCAAGGCTTAAAGAGATAGG - Intergenic
928808486 2:35191967-35191989 AGCTCAAGGCTGGAAGTTATTGG - Intergenic
929903333 2:46024688-46024710 TGTCCAAGGATGAGAGTGAATGG + Intronic
933569868 2:83997329-83997351 TGCCAAGGGCTGCAAGAGATGGG - Intergenic
933948460 2:87308475-87308497 TTCTCAAGGCTGAAAATGTTGGG - Intergenic
935128388 2:100243262-100243284 TGTCCAAGGCTGAAGGTGTGAGG - Intergenic
935818955 2:106874552-106874574 TGGCCAAAGCGGAAAGGGATGGG + Intronic
936331739 2:111553120-111553142 TTCTCAAGGCTGAAAATGTTGGG + Intergenic
937308955 2:120889938-120889960 TGCCCAAGGGTGTAACTGTTGGG - Intronic
937755926 2:125538641-125538663 TGCCCAAGGCAGGAAGGGAAAGG - Intergenic
938707850 2:133949024-133949046 TGCCAAAGGCTGAGAGGAATGGG - Intergenic
939152823 2:138493485-138493507 TGCCTAAGGCAGAAAGAGATGGG + Intergenic
939285907 2:140128941-140128963 TGCCCAAGGATGGTATTGATGGG + Intergenic
944630738 2:201621355-201621377 TGCCCAGGAGTGAAACTGATGGG - Exonic
946173767 2:217910465-217910487 GCCCCAAGGCTGGAAGTGTTGGG - Intronic
1169914279 20:10671867-10671889 TGCCTGAGGGTGTAAGTGATAGG - Intronic
1170351249 20:15444074-15444096 TGCCCAAGGTTGAGAGAGAGGGG - Intronic
1172248954 20:33465574-33465596 AGGCCAGGGCTGAGAGTGATTGG + Intergenic
1172587837 20:36097185-36097207 TGCCAAAAGGGGAAAGTGATTGG - Intronic
1179815553 21:43903943-43903965 TGGACAAGCCTGAAAGTGAAAGG - Intronic
1179986724 21:44926295-44926317 TGCACAAGGCTGGAAGTCAGAGG + Intronic
1180670564 22:17549351-17549373 AGCCCTGGGCTGAAAGTGACTGG - Exonic
1183351607 22:37337680-37337702 TGCCCAAGGCGGACAGAGAGGGG - Intergenic
1183776063 22:39966552-39966574 TGCCCAAGGATGAAGGAGTTGGG + Intronic
1183860903 22:40669255-40669277 TGGCCAGGGCTAAAAGTGTTTGG + Intergenic
950177634 3:10886354-10886376 TGCCCAAGGCTGTATGGGACAGG - Intronic
950890542 3:16400370-16400392 TGCCCCAGGCTGGCAGTGTTGGG - Intronic
951940672 3:28075483-28075505 TGCACATGGCAGAAAGTGTTAGG - Intergenic
954423050 3:50428719-50428741 TGCCCAAGGAAGAAACTGAGGGG + Intronic
956170772 3:66431782-66431804 TGCCCAAGGCTGAGATGGAAGGG - Intronic
956638557 3:71391676-71391698 TGCCCAATGCTGAGAGTTAGTGG - Intronic
956936422 3:74107036-74107058 TGCCCAAGGGTGCAATTGCTGGG - Intergenic
963273719 3:143309847-143309869 TTCCCAAGGGTGAGAGTGAGAGG + Intronic
963877010 3:150487261-150487283 CCCCCAAAGCTGAAAGTGAAGGG + Intergenic
967401658 3:189069622-189069644 TGCCCAAGACTGAAATTTCTGGG - Intronic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
969410394 4:7024390-7024412 TGCCCAACACTGACAGTGCTCGG - Intronic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972797166 4:42433129-42433151 TTACCAAGGCAGAAAATGATTGG - Intronic
973970006 4:56203987-56204009 TGCACAAGGCTTCAAGTCATGGG - Intronic
975110588 4:70618740-70618762 TGCAAAATGCTGACAGTGATAGG + Intergenic
976326779 4:83780486-83780508 TGCCCAAGGGAGAAAGAGAAGGG + Intergenic
978025412 4:103867470-103867492 TGCCCAGGGCAGAATGGGATTGG + Intergenic
978082403 4:104610002-104610024 TACCAGAGGCTGATAGTGATGGG - Intergenic
979124618 4:116952679-116952701 TGCCCAGGGCTGGAGTTGATTGG + Intergenic
979200152 4:117967947-117967969 TGCTCAGGGCTGGAATTGATTGG - Intergenic
985965480 5:3336178-3336200 TGCCCAAGGCCCTGAGTGATGGG - Intergenic
986861360 5:11929947-11929969 TACCCAAGGCTAATAGTGAGGGG + Intergenic
987201987 5:15586415-15586437 TTCCCAAAGCACAAAGTGATGGG + Intronic
991256048 5:64616200-64616222 CTCTCAAGGCTGAAAGTGTTTGG + Intergenic
993473291 5:88333128-88333150 TGCCCAAGAGTGAAATTGTTGGG + Intergenic
993563042 5:89435849-89435871 TCCCAAAGGTTGAGAGTGATTGG - Intergenic
995313168 5:110736834-110736856 TGAGAAAGGGTGAAAGTGATAGG - Intronic
997410055 5:133684191-133684213 AGCTCAGGGCTGAAAGTGACGGG + Intergenic
998101618 5:139439484-139439506 TGCCCGAGGCTGAAAGAGAAGGG + Exonic
1000249194 5:159477848-159477870 ATCCCAAAGCTGAAAGTGATTGG + Intergenic
1000469000 5:161615710-161615732 TTCTCAAGGCTTAAAGTGTTTGG - Intronic
1001441967 5:171750305-171750327 TGCCCAGGCCTGAAAGTCATGGG - Intergenic
1001685678 5:173593179-173593201 TACCCAAGGCTCACAGTGAGTGG - Intergenic
1002615444 5:180451986-180452008 TCCCCATGGCTGAATGTGAATGG + Intergenic
1003631879 6:7794773-7794795 TGCCCAGGGTCGTAAGTGATAGG + Intronic
1004423941 6:15495075-15495097 TGCCCAAGGTGTTAAGTGATGGG + Intronic
1004947628 6:20633198-20633220 TGCCTAGGGCTGAGAGGGATAGG - Intronic
1006090395 6:31625389-31625411 TGAACACAGCTGAAAGTGATGGG - Intronic
1008590076 6:52985537-52985559 TGCCCATGGTTGAAATTGACGGG - Exonic
1009668709 6:66717069-66717091 TGCATAAGAATGAAAGTGATGGG - Intergenic
1011459265 6:87586609-87586631 GTCCCAAGGCTAAAAGTGAACGG - Intronic
1013742147 6:113299830-113299852 TGGCCTATGCTGAAAGTGAAAGG - Intergenic
1018173567 6:161160888-161160910 TCCCCAGGGCAGAAAGTAATAGG + Intronic
1018219652 6:161565448-161565470 GGACCAAGGGTGGAAGTGATTGG + Intronic
1019545255 7:1571070-1571092 TAGCAGAGGCTGAAAGTGATTGG + Intergenic
1019889463 7:3934709-3934731 TGCGCAAGGCTGAAAGAGATGGG + Intronic
1022967510 7:35487278-35487300 TGCCCAAGGGTGGAAGAGCTGGG - Intergenic
1024842434 7:53602989-53603011 TGCCCAAGCCTGTAAATGAGAGG + Intergenic
1024976942 7:55122189-55122211 TGAGCAAGGCTGAGAGTGCTGGG - Intronic
1027566480 7:79801097-79801119 TGGCAAAGGCTGAAAGAGTTTGG - Intergenic
1029165179 7:98583742-98583764 TGCCCAAGGCTGGAGGGCATTGG + Intergenic
1031740690 7:125426326-125426348 TGCCCTAGGCTGTAAGTCAGGGG - Intergenic
1031803164 7:126274996-126275018 GGACCAAGGGTGGAAGTGATTGG - Intergenic
1033174625 7:139112878-139112900 TGGCCAAGGGTGAGAGGGATTGG - Intergenic
1033229969 7:139588934-139588956 TGCCCGAAGCTGAGAGTGAAGGG - Intronic
1033572780 7:142649157-142649179 TGGACATGGCTGATAGTGATAGG + Intergenic
1035359693 7:158302569-158302591 TGCCCTAGGTTGAATGTGCTGGG - Intronic
1035950560 8:4016008-4016030 TGTCCAAGGCTGAAAGACAGTGG - Intronic
1036405452 8:8450878-8450900 TGCACAAGGCTGAGAAGGATGGG + Intergenic
1037081618 8:14794654-14794676 TTCCCAAGACTGAAAGGTATAGG + Intronic
1039214473 8:35254076-35254098 AGCACAAGGCTGAATGTGAGAGG - Intronic
1040041788 8:42923300-42923322 TGCCTAGGGGTGAAACTGATGGG - Intronic
1041224993 8:55689354-55689376 TGCCCAAGGCTGGAAGAAATCGG - Intergenic
1041607798 8:59804274-59804296 TGTCCAAGAGTGAAATTGATGGG + Intergenic
1043763548 8:84100124-84100146 TTCCCAAGGCTTAGGGTGATTGG + Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1045415986 8:101968065-101968087 TATACAAAGCTGAAAGTGATGGG - Intronic
1046362926 8:113185634-113185656 TGCCCATTGTTGAAAATGATGGG + Intronic
1046425247 8:114039196-114039218 TGTCCAATGCTGAGAGTGATGGG - Intergenic
1047087577 8:121535798-121535820 TGCCCAGGCCTGAAAGGGAAAGG + Intergenic
1047329921 8:123877525-123877547 TGCCCACTGCTGAAGGTGTTTGG - Intronic
1048166612 8:132067218-132067240 TGCCCAAAGCAGAAAGGGAGGGG + Intronic
1049496404 8:142936289-142936311 TTCTCAAGGTTGAAAGTGTTGGG + Intergenic
1050188686 9:3002042-3002064 TGCTCAAAGCTCAAAGTAATTGG + Intergenic
1051944866 9:22555687-22555709 TCTCCAAGTCTGAAAGTGAAAGG + Intergenic
1052326638 9:27222237-27222259 AGACCAAACCTGAAAGTGATGGG + Intronic
1052885321 9:33641211-33641233 TGGACATGGCTGATAGTGATAGG + Intergenic
1058219969 9:102286530-102286552 TACCCAAGGATGAAACTGGTAGG + Intergenic
1060472403 9:123959157-123959179 TGCCCAAGGCTGTGAGTAAGTGG - Intergenic
1062029081 9:134353914-134353936 TCCCCAAGGCTGGTGGTGATGGG + Intronic
1186470366 X:9816706-9816728 AGCCCAAGGGTGATAGTGCTCGG + Intronic
1188064877 X:25646456-25646478 TACACTAGGCTGAAAGTGAAGGG - Intergenic
1190837927 X:54118465-54118487 TGCCCAAGAGTGTAAGTGCTGGG + Intronic
1196874847 X:120147785-120147807 GACCCAAGGGTGAAAGTGAAAGG + Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1197356464 X:125441968-125441990 TGCCAAAGACTGAAACTAATTGG - Intergenic
1197480577 X:126980181-126980203 TGGCAAAGGTTGAAAGTGAGAGG - Intergenic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic