ID: 1083941622

View in Genome Browser
Species Human (GRCh38)
Location 11:65899438-65899460
Sequence ACGTGTCGACAGGGGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083941622_1083941628 -3 Left 1083941622 11:65899438-65899460 CCTTCCCTCCCCTGTCGACACGT 0: 1
1: 0
2: 0
3: 4
4: 147
Right 1083941628 11:65899458-65899480 CGTGCTCGCAGCCCCTCGACAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1083941622_1083941635 22 Left 1083941622 11:65899438-65899460 CCTTCCCTCCCCTGTCGACACGT 0: 1
1: 0
2: 0
3: 4
4: 147
Right 1083941635 11:65899483-65899505 ATGGGCACCTGCAGCCTCCCGGG 0: 1
1: 0
2: 2
3: 42
4: 369
1083941622_1083941634 21 Left 1083941622 11:65899438-65899460 CCTTCCCTCCCCTGTCGACACGT 0: 1
1: 0
2: 0
3: 4
4: 147
Right 1083941634 11:65899482-65899504 AATGGGCACCTGCAGCCTCCCGG 0: 1
1: 0
2: 3
3: 31
4: 275
1083941622_1083941630 4 Left 1083941622 11:65899438-65899460 CCTTCCCTCCCCTGTCGACACGT 0: 1
1: 0
2: 0
3: 4
4: 147
Right 1083941630 11:65899465-65899487 GCAGCCCCTCGACAGGAAATGGG 0: 1
1: 0
2: 0
3: 8
4: 49
1083941622_1083941629 3 Left 1083941622 11:65899438-65899460 CCTTCCCTCCCCTGTCGACACGT 0: 1
1: 0
2: 0
3: 4
4: 147
Right 1083941629 11:65899464-65899486 CGCAGCCCCTCGACAGGAAATGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083941622 Original CRISPR ACGTGTCGACAGGGGAGGGA AGG (reversed) Intronic
900370816 1:2331356-2331378 ACGTGGCCACAGGGGTGGGCGGG + Intronic
903985055 1:27221085-27221107 ATGGGTCAACAGTGGAGGGAAGG - Intergenic
905631748 1:39522778-39522800 AGGTGTGGGCAGGGGAGGGCCGG + Intronic
908062701 1:60369146-60369168 ACTACTAGACAGGGGAGGGAGGG - Intergenic
910791311 1:91054120-91054142 ACGAGTGGAGAGGGGTGGGAGGG - Intergenic
912233161 1:107818824-107818846 GCATGTCGAGAGGGGAGGGCTGG - Intronic
913341205 1:117759517-117759539 CCATGTCGACAGGAGAGGGGAGG + Intergenic
915895536 1:159808629-159808651 ACATGTAGCCAGGGGAAGGAGGG + Intronic
915920745 1:159973591-159973613 ACATGTAGCCAGGGGAAGGAGGG - Intergenic
918145964 1:181756066-181756088 CCGTCTCCACAGGGGAAGGATGG + Exonic
924503064 1:244654041-244654063 ACGTGACCACGGGAGAGGGAAGG + Intronic
1063735461 10:8748883-8748905 ATGTGTTGATAGGGGAAGGAAGG - Intergenic
1064102505 10:12475889-12475911 AAGAGTTGACAGGAGAGGGAGGG + Intronic
1066417080 10:35231548-35231570 ACTTGTGGACAGGGCATGGAGGG - Intergenic
1067659833 10:48226308-48226330 AATTGTAGATAGGGGAGGGAAGG - Intronic
1075615444 10:123887676-123887698 ACGTGCCAACAGAGGAGGAAGGG - Intronic
1076605543 10:131687062-131687084 ACGGGGCGCCAGGGGAGGGGAGG - Intergenic
1082711879 11:56562145-56562167 ACATGGCGACAGAGGAGAGAGGG - Intergenic
1083605294 11:63975031-63975053 AGGAGGCGACAGGAGAGGGAGGG - Intronic
1083726834 11:64632958-64632980 ATGTGTCACCAGGGGAGGAAGGG + Intronic
1083878764 11:65538148-65538170 ACGTGCAGACAGGGTAGCGAAGG - Exonic
1083941622 11:65899438-65899460 ACGTGTCGACAGGGGAGGGAAGG - Intronic
1085305253 11:75482112-75482134 TCGTGGGGACAGGGGAGGGGCGG - Intronic
1086124692 11:83338400-83338422 ACTTCTAGACTGGGGAGGGAGGG + Intergenic
1086895675 11:92309323-92309345 ATGTATGGACAGGGAAGGGAAGG - Intergenic
1087876818 11:103369102-103369124 GCTTGGAGACAGGGGAGGGATGG - Intronic
1089443042 11:118531920-118531942 AAGTGCAGACAGGGGAGAGAGGG - Intronic
1090654316 11:128831432-128831454 AAGTGAAGACAGGGGAGGGTAGG - Intergenic
1091319216 11:134637984-134638006 AGGTGCTGACAGGGCAGGGATGG - Intergenic
1095049868 12:37545877-37545899 AGGGGGCGGCAGGGGAGGGAGGG - Intergenic
1095962965 12:47846803-47846825 AGGTCTCTGCAGGGGAGGGAGGG + Exonic
1096706200 12:53423986-53424008 AAGTGTCTACAGGGAGGGGAAGG + Intronic
1096750440 12:53755639-53755661 AAGTGTCCACAGGGGTGGGATGG + Intergenic
1108422665 13:50266661-50266683 AAGTGTCAACAGGGCAGGGGAGG - Intronic
1108965616 13:56296564-56296586 ACAACTAGACAGGGGAGGGAAGG - Intergenic
1111677894 13:91409859-91409881 ACTTCTAGAGAGGGGAGGGAGGG - Intronic
1113593535 13:111516778-111516800 ACTACTAGACAGGGGAGGGAGGG - Intergenic
1113680187 13:112238544-112238566 AGGTGCCGAGAGCGGAGGGAGGG - Intergenic
1116160581 14:41262801-41262823 ACTACTAGACAGGGGAGGGAGGG - Intergenic
1117675567 14:58152006-58152028 ACGTGGCGCCGGGGCAGGGACGG - Intronic
1120963019 14:90142108-90142130 ACCTGGGGACAGGGAAGGGAGGG - Intronic
1121507267 14:94486564-94486586 AGGAGGGGACAGGGGAGGGAGGG + Intergenic
1121523039 14:94599509-94599531 ACCTTTGGCCAGGGGAGGGAGGG - Intronic
1122332551 14:100932905-100932927 ACGGGTTGGTAGGGGAGGGAGGG - Intergenic
1124215911 15:27807045-27807067 GCGGGTAGACAGGGGAGGCAGGG - Intronic
1128061196 15:64736964-64736986 ACGTGTGGGCAGGGCAGGGTGGG + Intergenic
1128329413 15:66745922-66745944 AAGTGGGGACAAGGGAGGGAGGG - Intronic
1128483588 15:68061950-68061972 TTGTGTCCACAGGGTAGGGATGG - Intronic
1128920482 15:71605820-71605842 AAGTGTAGACAGAGGAGAGATGG + Intronic
1129870223 15:78935210-78935232 ACCAGTAGACAGGAGAGGGAAGG - Intronic
1134112187 16:11522531-11522553 AAATGTCCCCAGGGGAGGGAGGG + Intronic
1134112361 16:11523606-11523628 AAATGTCCTCAGGGGAGGGAGGG + Intergenic
1137543078 16:49378006-49378028 ACGGCTGGACAGGGTAGGGAGGG - Intronic
1144447503 17:15344554-15344576 GAGTGTCAACAGGGGAGGGGAGG + Intergenic
1147188720 17:38726636-38726658 ATGTGGGGTCAGGGGAGGGAAGG - Exonic
1147364424 17:39951111-39951133 AGCTGTCCACAGGGCAGGGAGGG - Intergenic
1148231371 17:45937273-45937295 AGGTGCTGACAGGGGAGAGAAGG + Intronic
1148391615 17:47276694-47276716 ATGTGGTGACCGGGGAGGGATGG + Intronic
1150243450 17:63655171-63655193 ACATGGCGACAGGAGAGAGAAGG + Intronic
1151517197 17:74604266-74604288 AGGTGTAGACAGGGAGGGGAAGG - Intergenic
1152350692 17:79782429-79782451 ACCTGTCCTCAGGGGAGGGAGGG - Intronic
1152719220 17:81914715-81914737 ACGGGTGGCAAGGGGAGGGATGG + Intronic
1155804204 18:30145371-30145393 ACGTGTCTTCAGGGCAGGGTAGG - Intergenic
1158239347 18:55359612-55359634 ACGTGTCTACTGGGTAGAGATGG - Intronic
1161596690 19:5154281-5154303 GGGTGTGGGCAGGGGAGGGATGG + Intergenic
1162606364 19:11711400-11711422 ACTAGTAGACGGGGGAGGGAGGG - Intergenic
1166991536 19:46695716-46695738 ACGTGTCAAAAGAGGAAGGAGGG + Intronic
1166994924 19:46715828-46715850 AGGTGTAGAGAGGGGAGGAAGGG - Intronic
925567089 2:5268088-5268110 ACGTTTAGAGATGGGAGGGAGGG - Intergenic
930439618 2:51390162-51390184 GCCTGTGGAAAGGGGAGGGAAGG - Intergenic
931006700 2:57857957-57857979 ACAACTAGACAGGGGAGGGAGGG - Intergenic
932202320 2:69841603-69841625 ATGTGTGGAGAGGGGAGGGAGGG + Intronic
933167613 2:79093428-79093450 AGGTGTCTACAGGAGAGGCATGG + Intergenic
934082599 2:88482030-88482052 ACCTGTCAACAGGTAAGGGAAGG - Intergenic
937651664 2:124326131-124326153 AAGTGGAGACAGAGGAGGGAAGG + Intronic
942971541 2:181962835-181962857 ACATGAAGACAGGGGAAGGAAGG + Intronic
944081420 2:195792787-195792809 ATGTGGGGGCAGGGGAGGGATGG + Intronic
944095880 2:195967945-195967967 ACTTGTGGAAAGAGGAGGGAAGG - Intronic
944139461 2:196439413-196439435 AGGTGGAGACAGGGGAAGGATGG - Intronic
947687067 2:232097473-232097495 GCCTGTGGAAAGGGGAGGGAAGG - Intronic
947746967 2:232512839-232512861 ACGTGTGTGCAGGGGAGGGTTGG + Intergenic
1171040129 20:21755206-21755228 ACATGTCAAAAAGGGAGGGAAGG + Intergenic
1172745628 20:37205999-37206021 ACGTGTCAACAGAGTAGTGATGG + Intronic
1175870092 20:62205149-62205171 ACATGAAGACAGGGCAGGGACGG - Intergenic
1176386150 21:6139374-6139396 AGGTGTCCACAGGGGAGAGTGGG + Intergenic
1178674634 21:34620787-34620809 ACCTGTCCATAGGGCAGGGATGG - Intergenic
1179626284 21:42651285-42651307 ACGTGGCCAGAGCGGAGGGAGGG - Intergenic
1179737323 21:43398878-43398900 AGGTGTCCACAGGGGAGAGTGGG - Intergenic
1180036313 21:45252195-45252217 ACGTGTTGGCAGTGGGGGGAGGG + Intergenic
1181941488 22:26481075-26481097 ACGTGGGGACAGGGGAGGATGGG - Intronic
1182039355 22:27224521-27224543 ACCTGGAGACAGGGGAGGCATGG + Intergenic
1183348257 22:37319684-37319706 TCGGGCAGACAGGGGAGGGAGGG - Intergenic
1184731330 22:46372588-46372610 ACGTCTACACATGGGAGGGATGG - Intronic
1185009661 22:48306017-48306039 AGGTGTGGACAGGGGAGGTGTGG + Intergenic
1185291664 22:50030579-50030601 ACGTGGCGACAGGGGCAGGCCGG + Exonic
950890525 3:16400314-16400336 GAGGGTCAACAGGGGAGGGAGGG - Intronic
951540123 3:23774655-23774677 AGGTTTGGCCAGGGGAGGGATGG - Intergenic
953332917 3:42069386-42069408 AGCTGTCAACAGGGGAGGGCTGG + Intronic
953641358 3:44711139-44711161 ACGGGTTGAGAGGAGAGGGAAGG - Intergenic
954673157 3:52301340-52301362 CCGTGAGGACAGGGCAGGGATGG + Intergenic
961456028 3:127024431-127024453 ATGTGTGGGCAGTGGAGGGAGGG + Intronic
961819275 3:129566995-129567017 TGGTGTGGACAGGGGAGAGAGGG + Intronic
963305811 3:143651649-143651671 AAGTGTCTAAAGGGGAGGTAAGG + Intronic
964093791 3:152907819-152907841 ACTCCTAGACAGGGGAGGGAAGG + Intergenic
968986909 4:3880563-3880585 GCGTGTGGCCGGGGGAGGGACGG - Intergenic
969334128 4:6496937-6496959 ACGTATGGACGGGGGTGGGAGGG + Intronic
970653290 4:18201559-18201581 ACGTGACGGCAGGAGAGAGAGGG + Intergenic
971041349 4:22755833-22755855 ACGTGTCCACAGTGGATGAATGG - Intergenic
974403659 4:61437845-61437867 AAGTGTTGCAAGGGGAGGGAGGG - Intronic
976379043 4:84378784-84378806 ACCTGTCAACAAGGGAGGGCCGG - Intergenic
985880690 5:2636787-2636809 ACCTGGCTTCAGGGGAGGGAGGG + Intergenic
986348931 5:6859096-6859118 ACCTGTCCACAGGGGACTGAAGG - Intergenic
990148255 5:52787706-52787728 AAGTGTCCGCAGGGGATGGAAGG + Intergenic
990352633 5:54934256-54934278 CCCTGTGGACAGGGGAGTGATGG + Intergenic
991245629 5:64506128-64506150 GCCTGGCGACAGTGGAGGGAGGG + Intergenic
991687387 5:69193937-69193959 ACGTGTGGCCAGGGGTGTGATGG - Intronic
997380649 5:133434084-133434106 ACGGGGCAAAAGGGGAGGGAGGG + Intronic
1000575287 5:162968759-162968781 ACATGTTGGCAGGAGAGGGAAGG - Intergenic
1000925844 5:167193087-167193109 TCCTGTTGATAGGGGAGGGAGGG + Intergenic
1005957214 6:30672614-30672636 AGGTGTCGGCAGGGGTGGGGAGG - Exonic
1006936234 6:37720485-37720507 AAATGTCAACAGGGAAGGGAGGG + Intergenic
1007370298 6:41422454-41422476 AGGGGTTGACAGGGAAGGGAGGG - Intergenic
1014527078 6:122513627-122513649 ACTACTAGACAGGGGAGGGAAGG - Intronic
1019751788 7:2735234-2735256 CCGTGGCCACAGGAGAGGGAGGG - Intronic
1024034716 7:45497559-45497581 ACATGTTGAAAGGGGAGGAAAGG + Intergenic
1029438555 7:100575370-100575392 ACGTGAGGGCAGGGGTGGGAGGG - Intronic
1033761770 7:144443344-144443366 ACGTGTAGACAGGCCACGGAAGG - Intergenic
1033886997 7:145961275-145961297 CCTTGTCCACAGGTGAGGGAGGG + Intergenic
1034530125 7:151690412-151690434 ATGTGTAGAAAGGGGAGGCAGGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035097148 7:156364990-156365012 ACGTGGCCCCAGGGGACGGATGG - Intergenic
1036621581 8:10427689-10427711 ACGGGTGGACAGGGTAGGGATGG - Intronic
1037425031 8:18746315-18746337 AAGGGTCAGCAGGGGAGGGAGGG - Intronic
1042317068 8:67435889-67435911 ATGTGGGGTCAGGGGAGGGAAGG - Intronic
1044820604 8:96153523-96153545 ACCGGTCGACAGTGCAGGGAAGG - Intronic
1047274729 8:123396802-123396824 AGGTGTCAACAGGGGTGGGGAGG - Intronic
1047959311 8:129999339-129999361 CCCTGTCCACAGGGAAGGGAAGG + Intronic
1049529586 8:143147727-143147749 GTGTGGGGACAGGGGAGGGAAGG + Intergenic
1049574596 8:143384436-143384458 ATGTGTGGGCAGGGGTGGGACGG - Intergenic
1053431538 9:38044912-38044934 ATGTGTACACAGAGGAGGGAGGG + Intronic
1055585084 9:77750674-77750696 ACGTGATTTCAGGGGAGGGAGGG - Intronic
1056946839 9:91004956-91004978 ACGGGGCGACAGGGCAGGAACGG + Intergenic
1058314990 9:103554253-103554275 ACGTGCTGGCAGGGCAGGGAAGG - Intergenic
1062100085 9:134723441-134723463 ATGTGGAGACAGGGGAGGCAGGG + Intronic
1185669333 X:1793177-1793199 TCATCTCGCCAGGGGAGGGATGG + Intergenic
1189740914 X:44116428-44116450 GTGTGTTGACAGGAGAGGGATGG - Intergenic
1194245491 X:91506535-91506557 ACTTCTAGAGAGGGGAGGGAGGG + Intergenic
1195660277 X:107371179-107371201 GCGTGTGGAGTGGGGAGGGAAGG - Intergenic
1196237299 X:113297819-113297841 ACATGAGGAGAGGGGAGGGATGG + Intergenic
1199972545 X:152871780-152871802 CAGTGTCGATAGGGAAGGGAAGG - Intergenic
1200098049 X:153673395-153673417 ATGTGTGGATGGGGGAGGGACGG - Intronic
1200564461 Y:4747787-4747809 ACTTCTAGAGAGGGGAGGGAGGG + Intergenic