ID: 1083941977

View in Genome Browser
Species Human (GRCh38)
Location 11:65900661-65900683
Sequence CCGCGCCCAGGTGGAGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 249}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083941963_1083941977 21 Left 1083941963 11:65900617-65900639 CCGCCCCCCTGACGTAGCTGCCC 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 249
1083941962_1083941977 22 Left 1083941962 11:65900616-65900638 CCCGCCCCCCTGACGTAGCTGCC 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 249
1083941964_1083941977 18 Left 1083941964 11:65900620-65900642 CCCCCCTGACGTAGCTGCCCATA 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 249
1083941970_1083941977 1 Left 1083941970 11:65900637-65900659 CCCATACATGGTGTAACTTCCTC 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 249
1083941967_1083941977 15 Left 1083941967 11:65900623-65900645 CCCTGACGTAGCTGCCCATACAT 0: 1
1: 1
2: 1
3: 5
4: 48
Right 1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 249
1083941968_1083941977 14 Left 1083941968 11:65900624-65900646 CCTGACGTAGCTGCCCATACATG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 249
1083941965_1083941977 17 Left 1083941965 11:65900621-65900643 CCCCCTGACGTAGCTGCCCATAC 0: 1
1: 0
2: 0
3: 2
4: 88
Right 1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 249
1083941966_1083941977 16 Left 1083941966 11:65900622-65900644 CCCCTGACGTAGCTGCCCATACA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 249
1083941971_1083941977 0 Left 1083941971 11:65900638-65900660 CCATACATGGTGTAACTTCCTCG 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083941977 Original CRISPR CCGCGCCCAGGTGGAGCCCC GGG Intergenic
900355296 1:2258872-2258894 CTGCTCCCAGGTGGGGCCCTGGG - Intronic
900589944 1:3454976-3454998 TCCCGCCCCGGCGGAGCCCCAGG - Intronic
901301649 1:8203834-8203856 GCTCGCCCAGGTTCAGCCCCAGG - Intergenic
901793027 1:11664414-11664436 CTGCGCCCAGGTCGCGTCCCCGG + Intronic
902067612 1:13700660-13700682 CCGGCCCCACGTGGGGCCCCAGG - Intronic
902311387 1:15584491-15584513 CCACGCCCATGTTGAGCCCTGGG + Intronic
903831912 1:26180568-26180590 CCCCGCCCAGGATGAGCTCCTGG - Exonic
904165674 1:28553326-28553348 ACGAACCCAGGTGGGGCCCCAGG - Intronic
905018487 1:34793092-34793114 CCGCGAGCAGGTGGCGCCCCTGG - Intronic
905307372 1:37029037-37029059 CCAGACCCAGGTGGGGCCCCAGG + Intronic
905626099 1:39491514-39491536 CCGCGCCCGCTAGGAGCCCCGGG - Intergenic
905741361 1:40374004-40374026 CCCCGCTCAGGAGGTGCCCCTGG + Exonic
905775096 1:40663333-40663355 CCTCTCCAAGGTGGTGCCCCTGG + Intronic
906035250 1:42746774-42746796 CCTCTCCCAGGAGCAGCCCCTGG - Exonic
910641919 1:89473182-89473204 CTGAGACCAGATGGAGCCCCAGG + Intergenic
912739649 1:112182338-112182360 CAGTGCCCTGCTGGAGCCCCGGG + Intergenic
913655103 1:120952757-120952779 CCCTGCCCTGGTGGAGCCCCGGG - Intergenic
914645288 1:149646917-149646939 CCCTGCCCTGGTGGAGCCCCGGG - Intergenic
915191661 1:154155937-154155959 CCGCACCCAGCTGGAGCAACAGG - Intronic
917975269 1:180233942-180233964 ACGCACCCCGGAGGAGCCCCAGG - Intronic
920385466 1:205568236-205568258 CCGCGTCCTGGAGGAACCCCGGG - Intergenic
922113146 1:222582583-222582605 CCACTCCCAGGTGTAGACCCAGG + Intronic
922161456 1:223081580-223081602 CCGCCCCCAGGTGGTGCTGCAGG - Intergenic
922978545 1:229805105-229805127 GCGGGTCCAGGTGGAGCCACTGG + Intergenic
1063458515 10:6201595-6201617 CCGCGCCCAGGCGGCGACCGGGG - Intronic
1066204985 10:33180228-33180250 CAGCCCCCAGGAGGACCCCCAGG + Exonic
1067681621 10:48445428-48445450 CCAGGCCCAGCTGGAGCTCCTGG - Intergenic
1069849734 10:71397089-71397111 GCGCGCCCAGTCCGAGCCCCCGG + Intronic
1070290764 10:75111821-75111843 CCGCGACCTGGAGGGGCCCCGGG + Intronic
1070566132 10:77605141-77605163 CCGCGCCCAGCCGCAGCCCAGGG + Intronic
1070800907 10:79243787-79243809 CCGCGCCCGGAGGGAGCCCAGGG - Intronic
1071462978 10:85916052-85916074 CCTGGGCTAGGTGGAGCCCCAGG + Intronic
1072503608 10:96043440-96043462 CCGGGCCCAGGTGCAGCGCCAGG - Intronic
1072637206 10:97185740-97185762 CCGCCTCCAGGTGCAGTCCCGGG + Exonic
1072926308 10:99620264-99620286 CAGGGCCCGGGCGGAGCCCCGGG - Exonic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1073057205 10:100710334-100710356 CGGCGCCCGGGAGGAGCCGCGGG - Intergenic
1073365205 10:102934569-102934591 CCGCGCCCAGCCTGAGCCACCGG + Intronic
1073403623 10:103278015-103278037 CCGCGCCCAGTATGAGTCCCTGG + Exonic
1075386692 10:122060290-122060312 AGGGGCCCAGGTAGAGCCCCAGG + Intronic
1076290761 10:129343658-129343680 CAGCGGCCAGGTGGGACCCCAGG + Intergenic
1076920966 10:133454493-133454515 CTGCACCCAGGTGGAGACACTGG + Intergenic
1077044090 11:536852-536874 CCGCACGTGGGTGGAGCCCCGGG - Intronic
1078019007 11:7640027-7640049 GCTCGCCCAGGGGGAGCCTCTGG - Intronic
1078729543 11:13962958-13962980 CCGCGGCCAGGGGCAGCGCCAGG - Exonic
1082160611 11:48884624-48884646 CTGCTCCCAGGAGGAGCCTCGGG - Intergenic
1082161755 11:48895782-48895804 CTGCTCCCAGGAGGAGCCTCGGG + Intergenic
1082167338 11:48964210-48964232 CTGCTCCCAGGAGGAGCCTCAGG + Intergenic
1082239692 11:49856996-49857018 CTGCTCCCAGGAGGAGCCTCGGG - Intergenic
1082242465 11:49887355-49887377 CTGCTCCCAGGAGGAGCCCCGGG + Intergenic
1083472890 11:62896088-62896110 CCGCGCCCAGCTGGAGCACCTGG + Intergenic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG + Intergenic
1084225806 11:67714088-67714110 CTGCCCCCTGGTGGAGACCCTGG + Intergenic
1084263629 11:67993945-67993967 CTGCCCCCTGGTGGAGACCCTGG + Intronic
1084809780 11:71605176-71605198 CTGCCCCCTGGTGGAGACCCTGG - Intergenic
1090190297 11:124762403-124762425 CCGCGCGCTGGGGGCGCCCCCGG - Intergenic
1091200885 11:133779923-133779945 ACTTGCCCAGGTGGAGTCCCTGG - Intergenic
1091594226 12:1864979-1865001 CGGCGCCCACCTGGAGACCCGGG - Intronic
1092196979 12:6555600-6555622 GGGCGCCCAGCTGCAGCCCCAGG + Exonic
1096647710 12:53047514-53047536 CCGCGGCCAGCCAGAGCCCCCGG - Intronic
1097264878 12:57738899-57738921 CCGAGCCCAGGCGAGGCCCCCGG - Intronic
1099365101 12:81758774-81758796 CCGCGTGCAGCTGGAGCCCCGGG + Intronic
1104688337 12:130805397-130805419 AAGGGCCCAGGTGGAGCCCAGGG + Intronic
1104785180 12:131444362-131444384 CTGGGCCAAGGTGGAGCCCACGG + Intergenic
1104857876 12:131910321-131910343 CAGGGCCCATGCGGAGCCCCAGG - Intronic
1108484401 13:50909936-50909958 CAGCGCCCGGGAGGAGGCCCAGG - Exonic
1112507002 13:99981420-99981442 CCGCGGTCAGGTGGAGCCGCTGG + Intergenic
1113459645 13:110472970-110472992 CCTGGCCCAGATGGATCCCCAGG + Exonic
1114631968 14:24164871-24164893 CCTGGCCCAGGTGGAGCCTGGGG - Exonic
1117029455 14:51652721-51652743 CGGCGCGCTGGCGGAGCCCCAGG + Intronic
1119650156 14:76377413-76377435 CAGCGCCCAAGGGGAGACCCGGG - Intronic
1119758343 14:77134234-77134256 CAGCGGCCAGGTGCTGCCCCAGG - Intronic
1121539445 14:94714042-94714064 CAGCACCCAGGAGGTGCCCCTGG + Intergenic
1121803881 14:96797550-96797572 CCGCACCCCGGTGGACCCACAGG - Intronic
1122775857 14:104116772-104116794 CCCGGCCAAGGTGGAGCCCCGGG + Intergenic
1123710159 15:22980686-22980708 CCCTGACCCGGTGGAGCCCCGGG - Intronic
1128145174 15:65328982-65329004 CCACCCCCAGATGGAGGCCCTGG - Exonic
1128452199 15:67812078-67812100 CTGGGGCCAGGTGGACCCCCAGG + Intergenic
1131118081 15:89806523-89806545 CCACGCCCAGGAGGATCCCCAGG + Exonic
1131157487 15:90084199-90084221 CCGCGCTCAGGAGGACCCGCCGG + Exonic
1132676852 16:1124529-1124551 CCGCCCCGAGGGGAAGCCCCCGG - Intergenic
1132889322 16:2196281-2196303 CCGCGCCGGGGAGGGGCCCCCGG + Intronic
1132994744 16:2817196-2817218 CCGCCCCCAGGGGGCGCCCCGGG + Intronic
1136536458 16:30902523-30902545 CGGCGCTCAGGCCGAGCCCCCGG - Exonic
1136637896 16:31537484-31537506 CCGGGCCCAGGCCGCGCCCCCGG + Intergenic
1137057156 16:35751262-35751284 CCGGGCCCTGGTGGGGGCCCAGG - Intergenic
1139311655 16:66032896-66032918 CCGGAGCCAGGGGGAGCCCCTGG + Intergenic
1139655461 16:68384617-68384639 CCCTGCCCATGTGGAGCCCTGGG + Intronic
1139946694 16:70646952-70646974 GCGCAGCCAGGTGAAGCCCCGGG - Exonic
1141203272 16:81913686-81913708 CCGCGCCCATGTGGAAACACAGG - Intronic
1141667332 16:85472653-85472675 CCTCCCCCTGTTGGAGCCCCAGG + Intergenic
1142173273 16:88633886-88633908 CCCCTCCCAGGGGGTGCCCCAGG + Intergenic
1142209160 16:88799743-88799765 CTGCCCCCGGCTGGAGCCCCAGG + Intergenic
1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG + Intronic
1143100922 17:4504273-4504295 CAGCACCCAGGTGAAGCGCCAGG + Intronic
1143108936 17:4542880-4542902 CCTGGCCCAGGAGCAGCCCCAGG - Intronic
1143373011 17:6451945-6451967 CCTAGCCCAGGTGCAGCCCCGGG - Exonic
1143487214 17:7261629-7261651 GCGCGCCCACGTGCAGCCGCCGG + Intronic
1143501878 17:7343947-7343969 GGGCGCCCAGGTGGGGCCCCAGG + Exonic
1143608357 17:8003493-8003515 CTGCGTCCAGGGGCAGCCCCAGG - Exonic
1143634390 17:8156077-8156099 CCTCGCCCCCGTGGAGTCCCTGG - Intronic
1143863603 17:9908457-9908479 CTGTGCCCAGGAGGGGCCCCAGG + Intergenic
1144515580 17:15915688-15915710 CCGTGTCCAAGTGGAGACCCAGG + Intergenic
1148764430 17:50028938-50028960 GCGCTCCCAGGAGGAGCCCATGG - Intergenic
1150266872 17:63837737-63837759 CAGAGCCCTGCTGGAGCCCCAGG + Intronic
1150699436 17:67434518-67434540 CCGCGCCCAGCCTGAGCTCCGGG - Intronic
1152244845 17:79179933-79179955 CGGCGCCCAAGTGGGGCTCCTGG + Intronic
1152468297 17:80477500-80477522 CCACGCACAGGTGGACACCCGGG - Intronic
1152523665 17:80875256-80875278 CAGAGACCAGGAGGAGCCCCTGG - Intronic
1152769933 17:82161391-82161413 CCGCTCCCAGGTGTACACCCAGG + Intronic
1152822223 17:82443199-82443221 CTGCGCCCGGCTGGAGCTCCCGG + Exonic
1152922810 17:83074256-83074278 CTGAGCCCACGAGGAGCCCCAGG + Intergenic
1152930573 17:83107607-83107629 CTGCCCCCAGCAGGAGCCCCAGG - Intergenic
1157584170 18:48790753-48790775 CCCCGCCCGGCTGGAGCCACGGG + Intronic
1158505548 18:58044045-58044067 CCGCGCCGCGCTGGAGGCCCCGG + Intergenic
1158857139 18:61554328-61554350 TCGCGGCCATGTGGAACCCCCGG + Exonic
1159891168 18:73954587-73954609 CAGAGCCCTGGTGGAGCCCTAGG + Intergenic
1160455233 18:78994757-78994779 GGGCGCCCCGGAGGAGCCCCAGG + Exonic
1160510294 18:79449752-79449774 CCCCATCCAGGTGGAGCCCCGGG + Intronic
1160575693 18:79852656-79852678 CCACGCCCAGGTGCAGGCGCTGG - Intergenic
1160708920 19:541861-541883 CCGCACCCCGGAGGAGCCACGGG + Exonic
1160863109 19:1245877-1245899 CCGCCCCCAGTTCCAGCCCCAGG + Intergenic
1160919826 19:1514085-1514107 CCGAGCCTGGGTGGAGCCCAGGG - Intergenic
1160930294 19:1567110-1567132 CCCCGCCCGGCCGGAGCCCCGGG + Intronic
1161030575 19:2056183-2056205 CCACCCCCAGCTGGAGCCCTGGG + Intergenic
1161102085 19:2426305-2426327 CCGGGTCCTGGTGGAGCACCAGG - Exonic
1161799894 19:6411792-6411814 CTGGGGCCAGGTGGAGCACCGGG + Intergenic
1162554979 19:11381197-11381219 CCGCCCCCAGGTGGAGATCCTGG - Exonic
1162739886 19:12767831-12767853 CTGCGCCCAGCTGCAGCCGCGGG - Exonic
1162966850 19:14160223-14160245 CCCCGCGTAGATGGAGCCCCGGG + Exonic
1163171312 19:15533022-15533044 CCACTCCCAGGTGTGGCCCCAGG - Intronic
1163772515 19:19199402-19199424 CCCAGCACATGTGGAGCCCCAGG - Intronic
1164836283 19:31357198-31357220 CCGCGCCAAGGGGCAGCCCCAGG - Intergenic
1165157516 19:33797069-33797091 CCCCGCCCAGGTCCAGACCCTGG - Intronic
1165375330 19:35437730-35437752 CCGCGCCCGGCTGGAGTCCATGG - Intergenic
1168339815 19:55616468-55616490 GCTCGCCCAGGTGCAGCCGCTGG - Exonic
926202650 2:10812771-10812793 CCGCGCCCACGTCCCGCCCCAGG + Intronic
927521923 2:23704066-23704088 CTGGGGCCAGCTGGAGCCCCGGG - Intronic
929429073 2:41871442-41871464 CCTCCCCCAGCTGGAGCCACAGG - Intergenic
930872623 2:56184169-56184191 CCTTGCCCAGCTGCAGCCCCCGG - Exonic
931021185 2:58046793-58046815 CTGCGACGAGGCGGAGCCCCCGG - Intronic
934648181 2:96071415-96071437 CCACTGCCAGGTGGAGCTCCAGG - Intergenic
934758569 2:96840882-96840904 CCAGGCCCAGGTGGAGCCTGTGG - Exonic
935636418 2:105252531-105252553 CCAAGCCCAGATGGGGCCCCTGG + Intergenic
936141812 2:109947669-109947691 GCGCGCCCAGGCGGGGCCTCCGG + Intergenic
936178500 2:110245617-110245639 GCGCGCCCAGGCGGGGCCTCCGG + Intergenic
936202878 2:110423815-110423837 GCGCGCCCAGGCGGGGCCTCCGG - Exonic
936433204 2:112482063-112482085 CCGCGCTCTGGAGGAGCCCGTGG - Intergenic
946183824 2:217965640-217965662 CTCAGCCAAGGTGGAGCCCCAGG + Intronic
947549659 2:231037441-231037463 CCGAGCCCAGCCGGACCCCCGGG - Intergenic
947766623 2:232641976-232641998 GCGCTCACAGCTGGAGCCCCGGG + Intronic
948062752 2:235053666-235053688 CCAGGCCCAGGTGCAGCTCCTGG - Exonic
948366227 2:237456517-237456539 CCGAGCCCACTTGGAGTCCCTGG + Intergenic
948855511 2:240728575-240728597 CAAGCCCCAGGTGGAGCCCCTGG + Intronic
1170557980 20:17530993-17531015 GCGCGCCCGGCTGGAGCGCCAGG - Exonic
1172385618 20:34532065-34532087 CAGAGCCCAGGTAGAGCCCTGGG - Intronic
1172645680 20:36467825-36467847 GAGCGCCCTTGTGGAGCCCCTGG - Intronic
1173253111 20:41375031-41375053 CCCCACCCTGGTGGGGCCCCAGG + Intergenic
1173815621 20:45985927-45985949 CAGCGCCCTGCTGAAGCCCCTGG - Intergenic
1174354404 20:49988508-49988530 CCACCCCCAGGTGCAGCCCCAGG + Exonic
1175121097 20:56716927-56716949 CCTCTCCCTGCTGGAGCCCCAGG + Intergenic
1175414934 20:58794939-58794961 CTGGGCCCAGGAGGGGCCCCTGG - Intergenic
1175854314 20:62112222-62112244 ACACGCCCAGGTGCAGCTCCAGG - Intergenic
1175883914 20:62277385-62277407 CCGGCCCCGGGTGCAGCCCCTGG - Intronic
1175916456 20:62428244-62428266 CCCCGGCCAGGTGGAGCCCAGGG + Intergenic
1176042373 20:63072333-63072355 CCGCGCCCCGCTGCTGCCCCCGG - Intergenic
1178493890 21:33071076-33071098 CCGGGCCGAGGTCGCGCCCCAGG - Exonic
1180036725 21:45254011-45254033 CCCCGGTCTGGTGGAGCCCCCGG + Intergenic
1180036748 21:45254064-45254086 CCCCGGTCTGGTGGAGCCCCCGG + Intergenic
1180066654 21:45415785-45415807 CTGCAGCCGGGTGGAGCCCCAGG + Intronic
1180177889 21:46098868-46098890 CAGCGCCCCGGCGGAGTCCCAGG - Intronic
1180180860 21:46118171-46118193 CTCCTCCCAGGTGGAGCCCCAGG + Intronic
1180707498 22:17818400-17818422 CAGCGCCCAGGAGGAGCGCAGGG - Exonic
1183328906 22:37208939-37208961 CCACGCTCAGGAGGAGGCCCAGG + Intronic
1184163975 22:42716639-42716661 CCTAGCCCTGGTGCAGCCCCAGG - Intronic
1184409286 22:44317348-44317370 CCGCGCCCAGGAGGACTCCCTGG + Intergenic
1185128847 22:49026032-49026054 CCCCGCCCAGGTGACCCCCCAGG - Intergenic
952144343 3:30515369-30515391 CCCTGCCCAGGTTGAGCTCCTGG + Intergenic
953061833 3:39434233-39434255 AGGAGCCCAGGTGGAGCCTCTGG + Intergenic
953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG + Intronic
954333587 3:49903645-49903667 CCACGCCCAGGTCCAGGCCCAGG - Intronic
954418926 3:50408359-50408381 CAGCGACAAGGTGGAGCCTCAGG - Intronic
956452281 3:69386322-69386344 CCGCGCCCTGGGGAAGCGCCAGG - Intronic
958641828 3:96814742-96814764 CCTCGCGCAGGGGGCGCCCCGGG + Exonic
959849805 3:111072325-111072347 CCGCGCCCGGGGCGAGGCCCTGG + Intronic
967973919 3:195020316-195020338 ATGAGCCCAGATGGAGCCCCGGG - Intergenic
968568620 4:1327911-1327933 CCCCGCCAAGGTGTGGCCCCAGG + Intronic
968631765 4:1655567-1655589 CCGCGCCCAGGCGCAGGCCTGGG - Exonic
968674924 4:1871912-1871934 CCGGGCACAGGTGCAGCCGCAGG - Intronic
968969852 4:3788137-3788159 CTGGGGCCAGATGGAGCCCCAGG - Intergenic
969022145 4:4145851-4145873 CTGCCCCCTGGTGGAGACCCTGG + Intergenic
969240433 4:5893297-5893319 CCGCCCCCAGGCGGAGCGCAGGG + Intergenic
969252709 4:5980179-5980201 CCGCCTCCAGGAGGAGCTCCAGG - Exonic
969731722 4:8961541-8961563 CTGCCCCCTGGTGGAGACCCTGG - Intergenic
969791315 4:9495648-9495670 CTGCCCCCTGGTGGAGACCCTGG - Intergenic
972543129 4:40056646-40056668 CCGCGCCGAGGCGGAGCTCGGGG + Intergenic
983923514 4:173371528-173371550 CCGCCCCTCGGTGGGGCCCCAGG + Intronic
985663499 5:1169339-1169361 CAGGGCCCAGGTGGATCCACGGG + Intergenic
986400972 5:7379704-7379726 CCGCTTCCAGGTGATGCCCCTGG + Intergenic
990915947 5:60905997-60906019 GCAGGTCCAGGTGGAGCCCCTGG + Intronic
992749537 5:79849575-79849597 CCACCCCCAGTTGCAGCCCCTGG - Intergenic
998839030 5:146233626-146233648 CCGGGCCCAGGTCCAGGCCCAGG + Exonic
1001496089 5:172188402-172188424 CCGCTCCCCGGCAGAGCCCCGGG + Intergenic
1001683878 5:173578030-173578052 CCCCGCCAGGGTGGAGCCCATGG + Intergenic
1006298497 6:33180675-33180697 CCAGGCCCAGTTGGAGACCCTGG - Exonic
1006316780 6:33296141-33296163 CCGGTCCCGGGTGGACCCCCAGG - Exonic
1006645524 6:35512145-35512167 CAGAGCCCGGGTGGACCCCCAGG - Intronic
1007357659 6:41333011-41333033 CTGAGCCCAGGAGGAGCACCAGG + Intergenic
1008956551 6:57222057-57222079 CCGCGACCAGGAGGAGCCGGTGG - Exonic
1009437539 6:63635714-63635736 CCGCGCCTCCGTGGGGCCCCGGG - Intergenic
1011610546 6:89146405-89146427 CCGCGCCGAGTGGGAGCCGCCGG + Exonic
1013627536 6:111952554-111952576 CCGCTCCCTGGCAGAGCCCCTGG - Intergenic
1017905037 6:158752067-158752089 CCGAGCCCGGGTGGAGCGCCTGG + Intronic
1018037035 6:159890357-159890379 CTACTCCCAGGAGGAGCCCCCGG + Intergenic
1018378157 6:163232829-163232851 ACGCTCCCAGGAGGAGGCCCTGG + Intronic
1019360593 7:602452-602474 CCTGGCCCAGGTGGGGCTCCCGG + Intronic
1019747181 7:2707499-2707521 TCGTGCCCAGGTTCAGCCCCTGG + Intronic
1019918935 7:4150655-4150677 CAGGTCCCAGGTGAAGCCCCTGG + Intronic
1020309569 7:6857893-6857915 CTGCCCCCTGGTGGAGACCCTGG + Intergenic
1020461650 7:8434782-8434804 CCGCTCCCAGGTGTACCCTCCGG - Intronic
1023737539 7:43248207-43248229 CAGGGCTGAGGTGGAGCCCCAGG + Intronic
1026523135 7:71133084-71133106 CCGGGCACAGGGTGAGCCCCAGG + Intronic
1026898047 7:74021917-74021939 CCAGGCCCAGCAGGAGCCCCTGG + Intergenic
1026948933 7:74334411-74334433 CCGGGCCCAGGCGGACCCTCAGG - Intronic
1029482120 7:100819683-100819705 CCGGGACCTGGTGGAGCCCTGGG - Exonic
1029649159 7:101879187-101879209 CTGAGCCCAGGAGGAGTCCCTGG + Intronic
1030054934 7:105575745-105575767 CCGCACCCAGCTGAAGCCCCAGG - Intronic
1031114605 7:117654277-117654299 CAGGGCCCAGGTAGAGGCCCAGG - Intronic
1032540289 7:132697341-132697363 CCACTCCCTGGTGGAGCTCCTGG - Intronic
1033595315 7:142854882-142854904 CGGCGCACAGGCGGGGCCCCGGG + Intergenic
1034188335 7:149195868-149195890 CCGCGCCCAGGCGAGGCCCGAGG + Intronic
1034262568 7:149765946-149765968 CCTCGCCCCGGTGCAGCCGCTGG + Exonic
1034984273 7:155497618-155497640 GCTGGCCCAGGCGGAGCCCCTGG - Intronic
1035272810 7:157730473-157730495 CCTGGCCGAGGTGGTGCCCCAGG + Intronic
1035756107 8:2034202-2034224 CAGAGCCCAGATGGAGGCCCAGG - Intergenic
1036645416 8:10609150-10609172 CCTCGCCCAGCTGGCTCCCCAGG + Exonic
1036695535 8:10972149-10972171 CCGGGCCCAGCTGGGGCCTCGGG + Intronic
1038401541 8:27288023-27288045 CCGCGTGCAGGTGGAGAACCCGG - Exonic
1038450085 8:27634110-27634132 CCGCGCCCTGGAGGATCCGCCGG + Intronic
1039484270 8:37899105-37899127 CCGCGCCGAGGTGGACCTGCGGG - Exonic
1040521404 8:48179193-48179215 CAGAGCCCAGGGGGAGCCACAGG - Intergenic
1041369320 8:57142827-57142849 CCGCAGCAAGGTGGAGCCCGTGG - Intergenic
1041919822 8:63168942-63168964 CCGCGCGAGGGTGGAGCTCCGGG - Intronic
1043052790 8:75404290-75404312 CCGCGGCCAGAAGCAGCCCCGGG + Intergenic
1047223367 8:122937009-122937031 CCTGGCCCAGGTGGAACCTCTGG - Intronic
1049693456 8:143972766-143972788 CCACGCCCACGGGGAGCCCCTGG - Intronic
1049766540 8:144357878-144357900 AGGCGCCCAGTTGGAGTCCCAGG - Intronic
1049804781 8:144533920-144533942 CCGGGCCCAGGAAGAGCCCCCGG + Intronic
1049806869 8:144545053-144545075 CAGTGCCCAGGTGGGGCTCCAGG + Intronic
1050533921 9:6614523-6614545 CCACGCCCAGCTGAAGCCCTGGG + Intronic
1050708068 9:8426534-8426556 CTGCTCCCATGTGGAGCCCAAGG - Intronic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1057232906 9:93335626-93335648 CCCAGCCCAGGGGGCGCCCCGGG - Exonic
1057252606 9:93515995-93516017 CCCAGCCCAGGGGGCGCCCCGGG + Exonic
1059770020 9:117415402-117415424 GCGCCCCCAGGTGCAGCCTCTGG - Intergenic
1060585147 9:124781000-124781022 CAGCTCCCAGGTGCACCCCCAGG + Intronic
1060599522 9:124868908-124868930 CCGCGCCTCCGAGGAGCCCCTGG - Exonic
1060822817 9:126671390-126671412 CCGGGCTCAGCTGGGGCCCCTGG + Intronic
1061022804 9:128027101-128027123 CAGGGCCCAGGTCGAGCCCTGGG - Intergenic
1061088330 9:128412153-128412175 CAGGGCCCAGGTAGGGCCCCCGG - Intronic
1061365527 9:130171010-130171032 CCCTGCCCAGGCTGAGCCCCAGG - Intergenic
1062431161 9:136527457-136527479 CCGCGCCCACGGGGATCCTCAGG + Intronic
1062554250 9:137106906-137106928 TGGCGCCCACGTGGAGGCCCTGG + Intronic
1062558850 9:137130162-137130184 CCGCGCCCGGGTGAGGCCCTGGG - Intergenic
1062574499 9:137200063-137200085 CCGCGCCGCGGTGCAGACCCCGG + Exonic
1185464073 X:345099-345121 CCCGGGCTAGGTGGAGCCCCAGG - Intronic
1186618651 X:11215067-11215089 CAGGGCCCAGGAGCAGCCCCAGG + Intronic
1186638114 X:11427678-11427700 TCGCGCCCAGGGGCTGCCCCAGG - Intronic
1190265909 X:48827066-48827088 CCGCTCCCGGGAGGAGCCCGAGG - Intergenic
1192814223 X:74574242-74574264 CCGCGCCCAGCCAGAGTCCCTGG + Intergenic
1197173710 X:123462543-123462565 CCTCGCCCAGCTGGATCACCAGG - Intronic
1197749852 X:129957071-129957093 TCGCGCCCCGCTGAAGCCCCAGG - Intergenic
1199248435 X:145632391-145632413 CCGGGCCCAGTGGCAGCCCCAGG - Intergenic
1201159257 Y:11155806-11155828 CCGCGCCCAGCGCGAGCGCCTGG - Intergenic