ID: 1083946437

View in Genome Browser
Species Human (GRCh38)
Location 11:65925686-65925708
Sequence ACCCAGGAGTGGACCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083946437_1083946444 23 Left 1083946437 11:65925686-65925708 CCCTGGCAGGTCCACTCCTGGGT No data
Right 1083946444 11:65925732-65925754 TGTGTCCTAGGCATGGTTTGAGG No data
1083946437_1083946442 11 Left 1083946437 11:65925686-65925708 CCCTGGCAGGTCCACTCCTGGGT No data
Right 1083946442 11:65925720-65925742 CAAGCAGAGAGATGTGTCCTAGG No data
1083946437_1083946445 26 Left 1083946437 11:65925686-65925708 CCCTGGCAGGTCCACTCCTGGGT No data
Right 1083946445 11:65925735-65925757 GTCCTAGGCATGGTTTGAGGTGG No data
1083946437_1083946443 16 Left 1083946437 11:65925686-65925708 CCCTGGCAGGTCCACTCCTGGGT No data
Right 1083946443 11:65925725-65925747 AGAGAGATGTGTCCTAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083946437 Original CRISPR ACCCAGGAGTGGACCTGCCA GGG (reversed) Intergenic
No off target data available for this crispr