ID: 1083946441

View in Genome Browser
Species Human (GRCh38)
Location 11:65925713-65925735
Sequence CACATCTCTCTGCTTGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083946441_1083946447 24 Left 1083946441 11:65925713-65925735 CCTCTCACAAGCAGAGAGATGTG No data
Right 1083946447 11:65925760-65925782 GAAAAATCAGTGTCCATCAATGG No data
1083946441_1083946444 -4 Left 1083946441 11:65925713-65925735 CCTCTCACAAGCAGAGAGATGTG No data
Right 1083946444 11:65925732-65925754 TGTGTCCTAGGCATGGTTTGAGG No data
1083946441_1083946445 -1 Left 1083946441 11:65925713-65925735 CCTCTCACAAGCAGAGAGATGTG No data
Right 1083946445 11:65925735-65925757 GTCCTAGGCATGGTTTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083946441 Original CRISPR CACATCTCTCTGCTTGTGAG AGG (reversed) Intergenic
No off target data available for this crispr