ID: 1083946442

View in Genome Browser
Species Human (GRCh38)
Location 11:65925720-65925742
Sequence CAAGCAGAGAGATGTGTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083946439_1083946442 0 Left 1083946439 11:65925697-65925719 CCACTCCTGGGTTAAACCTCTCA No data
Right 1083946442 11:65925720-65925742 CAAGCAGAGAGATGTGTCCTAGG No data
1083946440_1083946442 -5 Left 1083946440 11:65925702-65925724 CCTGGGTTAAACCTCTCACAAGC No data
Right 1083946442 11:65925720-65925742 CAAGCAGAGAGATGTGTCCTAGG No data
1083946435_1083946442 12 Left 1083946435 11:65925685-65925707 CCCCTGGCAGGTCCACTCCTGGG No data
Right 1083946442 11:65925720-65925742 CAAGCAGAGAGATGTGTCCTAGG No data
1083946438_1083946442 10 Left 1083946438 11:65925687-65925709 CCTGGCAGGTCCACTCCTGGGTT No data
Right 1083946442 11:65925720-65925742 CAAGCAGAGAGATGTGTCCTAGG No data
1083946437_1083946442 11 Left 1083946437 11:65925686-65925708 CCCTGGCAGGTCCACTCCTGGGT No data
Right 1083946442 11:65925720-65925742 CAAGCAGAGAGATGTGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083946442 Original CRISPR CAAGCAGAGAGATGTGTCCT AGG Intergenic
No off target data available for this crispr